Description :
From Genome Similarity Track
Location :
scaffold_595:2215- 5055
Transcript NameFunction/comments
Pl_103567hypothetical protein PHYSODRAFT_455731

Sequence
2840 bases(100 bases per row)
ACGCCGGAAATCAAGAAGAGGACGACTGCTAGACGCAGAAAGAGACAGGAACAGCAGTCGGCCAATCTACGGCATACGGCACAACGCATTCTACTGAATA
GACTCAAACAACACAAACAGGAGATGAAGAAGAACGGAGCAGCGACATCTGCTGTTGCACCTGGGTTTACACTACCAGAACCTTCTAGTAAGAAGGTAGA
AATTGAAGAAACTAAAGAGGTAGAAGCTGAAGTAGATGAGGTAGAACGAACTACCGACGAAGTTGAAGAGAAGACAGAGGAGGATGGAGTACCGGTGGTG
TCGGATGCTGCAGTAGAATCAGAGGAGGGAGATGAAGAGCTAACGCTTGACGATATTGATCTGGACACGTCGAGGTTGTCGAAGATTGATCTTCATGCAG
TGTTTTCACTGCCGCCTCATTTACAGAAAGATATGATTCAGAAGATCCTGCGTGACAGACGTCAGGAAGTGAGAGATCAATTTATCCCATTAGCAGGGAA
CCCCGAGAAATACTCGCACACGCAGATTTCTGCTTTCTTGCAAACTAGTGAATTGAATCGACGGATTGAAGCAGCAAAGAGACAAAAGAGAGAGGAGGAG
ATGGAACATCAGGGTGGCGTTGGTCAAGGCCATCGCATTGACTCGAACAGCAACCGTTTTTACATCTACCAGAGAGATGCTGAGCAGAAAGAGGGGAAAG
ATGAAGATGATGTAGTATCAGAGGTCGAACGAACAGATATGGCTGAACGAGCCTCTGCTACTGAATCGTTGCAGGGCCAGGAGGACCAAAGTGACACCTT
TAAGGATGTGGAGAAACGACCACTGTCTGAGTTTACGCCGGGGAAGGCGGGATTTGTTCCAGATGATAAGGCGACGGAGGTTACTGCGGCGTGGGTTGCA
CGACATCAAGTTCGAGTCAAACAGGAACCTATGCTTGCGATTGAGAAACTCCGACGAGCCCAACTCAAGAAAGATGAACCAGCTTCCTCTGTCAAGCCTG
ATCCCAACGTCGCTGCCAAGCAACTTCCAGTACATGATGTCAGCGTTTCGTTAAAACTAGAAGATGTTGACTCAGAAGAAATGGCACGCTTTCAAAAGTT
GTTCCCAGTATCTGCAATAGAGTCCGCTACTGCTGCAATAACGGTGTCTTCAAGGACTGATGAAGTTGACGAAGACGATGATGTCGACTGGGAAGAAGTG
ACACCAACAGCAACAGATAAATCATCAGCTGCTTTTTCAAGCTCTGAAAACTCCGAGCAAAGAGTGCCGAGGCAGCCAATCAAGGCTGTGCCAACAAAAG
AACCTTGTACTGAACATGCGCTAAGCTCAAATAATCTTGGGATCGAGAAAGCAGAAAGCGATGAGGAGATGGAATGGGAAGATGTATCAAGTGAAATTGC
ATCTGCTGATTCTACACTTCCAGTGGGTGATATTCCTACTTTGAAGCAGACTAGTGCGGAAGAAAAACAACAAGTTCTTGATGTCGACTTTGGCAATTTG
GATGAACAAAACGTTGATGTTCAGGAGGATGAGGAAGAAGGCAAAGATGAACTGTTCCTGACACTGAAGAACGAGATGGAAGATGCAAAGGCGCATGAAG
ATCTAGACTTACTCAAAGATGAGGCGTTGCAGTCTGCTATGGCGACTGCTTCAAACCTGACTCAGTGGGCTGCTGGTGCTGTGCGACGAGCACTACAAGC
ACACTCGTTACAGCACGGTGGAAAGATAGGAGCTCATGGAAGTCCAAGCGGAGCACTAAAAGAAAGAGTGGCAGCTCAGTATATCCCTACAAAGGGTACA
GCGGGGGCTCCGCTTGAGGTGTCGGACGAAGAAGACGAGTCTAAGTCTTCCTTACCATATACCAAGCGTGATGAAGTGGTAGTTATCGATGTGGAAGAAG
ACGATGTACACGGTGATATTACAGTATCTACTGACGCTGATGAGAGCCATGAGCAGCTTCAAGCTGCATTGGCGGCTTCGATCGCTAGTGAACGAGAGGA
GCACGCTGAGAAAGGTGATAGTACTCGTGTTCGGTATCTTCAGTATTCTCAAAGTGAATCTTCTCTACCAAATGTAACGATAGACACTGCGCACCCAGAA
ATGGATGCGGCAGCATTGCAAAAGGAGCAACAGGAGCTCAAGAAACTCCGTAGTCGACAGCTGCGTGACACGGAAGGTATTACAGATGATATGGTGGCTG
AAGTGATGGCACTTTTGCGTTTATTTGGGGTTCCGTTTCTCGTTAGTCCCATGGAAGCTGAAGCTCAATGTGCAGCCCTAGAACAGCTAGGACTTGTGGA
CGGCGTTATCACAGATGACAGTGATATATTCCCATTCGGTGGTCAGCGAGTCTACAAAAACATTTTCCACCACCAGAAGTTTGTCGAAGCTTTTTCAGCG
CGTGATATTGAACAAGAACTTGGTTTTTCGCGAGAGCAGATTATTGCACTGGCACTACTACTTGGCAGCGATTACACGGATGGTGTCCGTGGTATTGGTA
TCGTAAATGCAACTGAGATTGCTGTTGCTTATCCTGGCATTGAAGGTCTCCGTGAATTTAAGGAATGGGTGCGTGAATTTGATGTTGCTGAAGAAGCCAA
GCGGGTTGCTTCGGGTGGACCCAAGAAGAGAAAGAAAAGGGGGACGCAAGGAAAAAATGATGAATCGGAAGAAGACTGTGGGGAAAGTGATGATGAGACG
GCTCGAGAACGGTTCCAGCAGTCTCACGCGACTGCACGGCGGAAGTGGGAATTAGGTGACGAGTTTCCGAGCAAGCAGGTGATCCAGGCGTACATGGCCC
CTCAAGTTGATCGCTCGGAAGCTCGATTTTCATGGAGCGC