Description :
From Genome Similarity Track
Location :
scaffold_27:22146- 28853
Transcript NameFunction/comments
g1348.t1hypothetical protein
g1349.t1hypothetical protein

Sequence
6707 bases(100 bases per row)
TATAGGCGTTTTTTCCACCTTCCAGACCTGCAACTTCCCTTCACTCCGTCGTGTGCGGATCTGAGACTCTTGTACAAGGCGTAAAACATTCACAGTCAAC
CCGGCATTCGTCGGGACGTATCGGAAGCAATATAATTCCTCTAAATCAGCTCCTGGAGCAAGTCGTAGCCCAACGCGCAGCAGTCGCTGGTACTTCTTCT
CCGTCAGCACCTGAAACTCGTCTACGAACTCCACAGCCGTAGCAGGCCGCACTACCACGCAATTTGATCGTGCTGAACACGCAAGGATGCATGTCGCGTC
CTGGAATTCTCGCTGGAACGCCGATACATTCACCATTTTCCCGCAAAACTTCAACTTTTACACTAGGGTTTGGCGAAAAAAAAAAACTCCAAAAATAATT
GAAGCAGACTAAAAGTAACGATAACATCAATTTGTTACATCTGAAGTAGTTTTAGCCGACTAAAAACGTTTTTGACTTCCCGCCATTTTCAAGACACAAG
GCGCCAGGCGTTCAAGGTACCACCAAGCTGAGGCGCATGGAGTCTCCCAGACGTGCGTCGGAGGTGGATGCGTCCTCCAACAAGCGTCGGCTCTCTGACA
TGTCCTTCTCACGGCCCGACAGCCCCCTACATGGCCCCAACGACAGCTTCGTCGAGTCTCAGCAATGCAGCGCAGACCCTTGCGCCTTCCTAGGGTTTCA
CGTGCCTCCAAGCGCCGAAGAAGTGGAGATACCACAGCCAAAGCTGCAAAAGGAGAAGAAGCAGACGTTTAAATTCGTACTGGACCTGGATACGTCGACA
GGAGGCGTCACAAGAGGTAGTGACGGCTTCCGACCTGTTGCAGCTAACCCATTCAGCGAATTATTCGCTGAAGACACGCAGGACAACGCGAATTTGATGG
CTCAAGCTCCAGTGGACAGTAAAGACGCTGTACAGCAAGTGGAGACGGCGGCCTTGACCATTGAGAAGAACAGCAGGCCGCCCACTATGTTGCAGTTGGA
GTCAGCATTGCGAGCACGGAAGGAGACAATTGGAGAAAAAAAAGCAAATGAAGAGAAAATAACGGAGGACTCTGTGACTGGGACCAGCGCGTATTCGGAG
TACAGTGAGGATCTCGCCCCGCGGATTTTTGTGACTGCAGTACCTGTCGCAAAATCGTCGGATGTTGGGACTATACAGGAACACGAGACGGAGAAGTTTG
ATTCGAGTGGTATTGCGGAAAATAGCGACCGTCTCACGGATTACGAGGATGACATGGAGTGCACGCAGCCACTTGAAGAAGATGACGATGACGCAGATGT
GACTAGAAATGATGGCGATGGTAGTGGTGATGATGAAGCAGAGACGGAAGTTTTTCCATATTCTGGTACAGGAACGTTGCCGTACATGGCAGACTCGATT
TATATGGATAGAATTGACGAAGAGAAGAGCAAAGAGGTTGCAGAAGATTCCTTTAGTGAAGAACGCGCGGCGGTTGTGTCTACCACGGATCAGAAACGTA
ATCAGCGGGCTAGTGAAGATGAAGTCACGAGTCGAGAAGGATCGCAAGCGACTCAGCAGGAATATCTGACGCCGAGAGTCAACCCTTGTCGAGTGGAGCA
GTTTGATTCAGCCGAACGGAGTACTCAGCCCGTTGTTGTCGTTGTTGCTTCTCGTGTCGAAGAGGAAGATGATTCAGAAAAGGAGCAAAGTGATGATGAG
CCAGAAGATTGTGTGCCTACTCAGCCCAGTAAGCCTCGTACAGAAGGCGAACCCGTCGTTGAGCCAAACTCGCCTTCCCCGTCAAATATTGCCAGGAAAA
GTGTCGTGGTGGCATCTGATTCTCAGACGAAAGCTATTCGCACCCTTGAGTTTTCTTTCTCGATGCCAGAGTCACAGGATGGTGAACCTCACTTCAGTGC
AAGTTTGACAAGTGAGGGCACACCAGCGGCCAAACAGATTGAAGCTTTCTCAAGGAACAGCAGACCCAGCCCATTCGAAACTTCTATCAGCCCGGTCTAC
CAGCCTACACCGACACCAGTGGAAGATACAGATGTCCCTGAAGCTACTATTACCACGGCCGAAACCCAAGTAAGCGCCAAGAGGAAAATTGTTTCCCCAT
TGCAATCTGGCATACCCACAGGTAAAAAGCAGAAAACTTCGTCTGAAGTTTTCAATTCCCCCAGTCAGATTGCCTCCACTCCCAAACCCAAGAAAAGGAA
GCGTGGGGTCTTCTCTCCCGACGGCAGCGGGTCGTTGAATAGGATAGAGTCTGACGCGTCCAATCCTCAAACACCACGACCCCCTGCCCGACGTAGCACT
CGATCAGCCCAGTCAACTCCCTTGTCGACCCCCCAAGTTCGAACACGAGCACGAAATTTAACGCCGGTGCCGCTACAGCGAAAGTACGCGTCCAGAACTC
GTGCTCAGACGCTGTTCAAGTACAAGTTTGAGTTTTGCTTGACGGGTTTCGTGAAAACTGGAGAAGAGAGTTTGAAGGAGTTTATTGAAGCACACGGAGG
TAAAATTCTGGAACGCTACCAAGACGTCTTGTACAAAAACAACCCCAAGGCGGTGGTGATCGCCACACCTGTATCGTGGAGGAAGCGCAAGTTTATGCAG
GCTGTTGCGTGTGGAATTCCTGTCGTCCATACTGACTGGATCAAAGATTGCGTTGACGCGGGGTATGTGCTACCGTTCGATGGGTACCAAGTACCTACAG
GTTATTCGGTCACCACCCGAAAGTCTGAGTGCTTTCCCCCTACAGAGGTAAACTTTTACGCTATATGACGCTCTTGGTAGAATATGAACTAACCTCTCTT
CGTTGCGGTTGCTACAGCTACACATTTTTGAAGGTTATTCCTTTGGCATCGCCAGTGATGTTTCTCAGACATCAAAATCCGAGGCTAAGGAAAGGGCCAG
TTTGACGACGTTTATATTAAAAGCTTGTGGTGCAGACGCTGTGTATGAGGTGAGTCCATTTTTTAGTAGCCTGCGCTCGTATCAATGGTATTGACATTTG
TGTCGTTTTATCGTAGAATTTGTCCAGTACAAGTGACGTTAGTGTGGATATCGTGCTATGCGATGAGTACACACCAGTAAGTGGCGTTGATAATGGGTTG
TTTGAGGTTCAATTGCTAATCTCTTTGACTTTGTTAGACATGCCGGTACTACAAGAGAAAACGTCACTTACCAGTTAAAAACTTCCAGTGGGTTACTGAG
TGCATGATTCTTCAGGTAAGCAACCATCTGCGAAACATGTTGAAAGTTGCTCGCATGGGTCTAAAAGTGCGAATATCTATTCTTCTGTTCAGAAAATGTT
GGATCCGGAGGAACCAGTCTTCGAGCCGCAGCGCGTCGGCAGTGAAGATGTGTTCACAGCAATCGCTGAGATCGGCGACAGTGACAAGTACGTCCTCTGA
TCTGTTTCTTCCGTTGTGAAGCAGTATCTAACTTGCTTGGTTCTGAATATTGTAGTTCCACCCTGAAACTCTACACCGGAGAACTCGTCATGGCAGACAT
TTCGGGTAGCGCAGCCGACCACTACCTCTTGTTTAACGTCTGCGAGATCTTGAGCATTCATGTGAGTGGCCGCAATGACGAAGGCTCGCAGTCAAAGCGA
AAGGAAAGTCGCGTTCAGCTTCGGGTTGGCATGTTGAAACGGTGCGTTTTTGTTTTGTCTTTGCCCAAAATTGAAACGTAGTACTGACCTAGTTCAATAT
GGTTTTCAACTGACAGCGAGCCTTATAGCCCTGAACTCTCGAAAACTCCTGTCAAAGTGCTGGATATATCGTCTGCGCAAGTGAAGAGAAGGGTTGTGGC
GATCTCGAAGAGCGACTACGCAGTGCTGAAGTATAAGGATGAAAGTATCTTTTGCTTGGAGGATGACAGCGAACCTGACAACGTTGCTGTGTCTAATGAG
CACAGGTGGCTAACCCAATAAACGCGCCGCTGGTTTTGTTATTATTAAGAGCTTTTGTAGTCTGGCGTTACATCACCCTCGGTGCCCTTCGGGGCCGCCT
TCCCTCGTATCCCGCTCATCAATCAACATTCGGTTTGGAATAAACAGATAAAGCCATGGCTAGGTCAAAGGAGTCATGTAAGTCTGGCGTATCGATCGTG
TACAGAGTTGTGCATGTACCTTTCGCATAGGGTCAACACCAGTATCCGAGAAAATAGTCTATTCGGAAAGGATAACAACGTGTAAGTGAAGTGAATGAAG
AGTTCTTGCTGTCTACGCGTACAGTACTTACCTGCCATGATATGATGCCTAGGTGGATAAGCATCATCCGGTAATAGTTAGTGAACGTCTCCGCAAGAAA
GCTCCATTTGCCTCGCAAGTCCTTAAACCAAACTTGAGGTTCTTCTGCTCACGAAAAGGTTAAATTAGCCAGACGCATAAAACAAAATGGTAAGTGCTAA
TGGCATGAATACCATCGAGGTAGACGAGAGCGACAGTGCCGTATTTCGGAGATTCCTCAAGCGAAAAGCCAATGAGTTCTTGGTGGTTGATCTGAAAGTC
AAAGAAGAGAATCTTAGCTCTTTCACAGTCGGCAAACAGGTATCTAGCCGTTGTACTTTTCTCAAATCAAGTCGATGCTGGTCAGCAGGGCGGCATTGAG
AAGGTAAATCCTTGATTGAGAGACGTTGTAAGTTTTGAAGCGAGTTCAGCAAGAAATGCCCTACTAAAGTGGTGTGGTCTGAATAGCCATAAGTGCAAGT
ATCTTGAAGTTCTTGACAATATTGTGTGCTGCTTACCGCGGAACGGCGCAAACCACTTCACCGACAGACCGTTCGTGGTCGAGTAGAATCGCTTCAAGTC
GTCTGGAAGCACAAAAGGAGAGTTTTTCTGAACTGGAGTAAGAATCGACTTGGAAAAAGTTGTCAGGCAGTACAGTAGAAATAATTCCTGTCCAACCTGT
TCCCACAGCCGAAGTTCTACTTGAGTAGCTCCAACAAAGGGCTTCGCTTCGACACGAGACACTCGTTCGTGGGCCTGCAAGTAAGAGAACACACCAAGAG
AAATGGCATCGAGGTGCTGCATGGTATAGCGACTGAACAGGCGCTAGTCCAAGATAGAAAAACGACAGTCAGACACGTCAACGTTGCAATTCTCTAGCAA
TGTTACGAAGGAATAGCAGCTACAACGATCTTCAATATGCGCAATTACGATCAGGTCACATAATAGAGCACTGTTCCTGGCCTGGGGCGCCACCAACTGC
ATCAGCATCATTGAAAGGCGCTTAGAAAACGAGCTAGGGCATTTGTCGCACAAACACGCAGACTTACGGGGCATTCCAGGCATTCCGGCCATACCGGGGA
ACATACCAGGGCCCTGTGAGATAGGGAACAAGAAGAACCACAATCAGTATGCCAGCATGTAACACCAAGCAACGTTAGACAAACCATGTTGGGCATGATC
GGCATTCCTTCATCATCAAACTGCAAGCCTGTACATCAAACAAATTTGGATTAATAGGATTAAAACCTCCTTGTCGCCATCAACACGTCAAAGAAGTTAC
CTGGGGCAAGATCCTTCACGATCTCGGACGGAGGCTGGCCAGTCTCCTGCATTTCCTGCATGAGCTCTGACAACCGAGCGTAGTTGTCGGGCTCCGACTC
GTACGCTGCGACGATCTGCTGGAAATATTGGTACTGCTTGCCGTATCTATGCCATGTGCCCCATAAAATGTTAATGGAGACCACCGACGCCCTTTGCACA
ATGTCTGCAGCACTAACCTTTCGTAGTCCTCTTTCGACAGCAAAGATTCCTTTTCGGCCAACCACTCCGGATACTATACAGTGAAAACAGCAGCAAGCCT
CAAGAGTCAGTAACAATTCCACATCGCCTTCACCTAAAGTAATTAGCGTACCCGCTCACAGATCTGCTTCATCGGGTCGTACATGACGTCCTTCGACAGC
AGCTGCTGCATCATACCGTCCACCAAGTCCTGGAAGTCACTCTGGAATTATCACACACGCATATTCAATCAATACCCCACATACGACATAAAAATACTGT
TGACTTGCTACCTTTTCCCCCATCTCCTCGAACTTCTTCATCATCTCAGCCATCATATCTTCGCCCATAGCTTCGACCTGTGCCGTACCCACACCTTCCA
TATCTTCCGCCGCCTTCGCCATATTCTGCAGCGTCTTGGCGACTCCAGCATTGACGTCGTCCGTCTCTGTTTGGCTGTCGTCCGTCTTCAGGGACCCCAG
TAGCTGCTCAATATTCTCCGCATCCGCTGAATCCATCCATATCATACAATTAGCATCTCCACAACACCCCACATTTACGCACAATACACCACTGAGTACC
ATCTGTGCCCAGCTCCTGAAAAGCTTGCTCCAGGACCTTCTGGAACTCTGGATTCTGTGCGTCCTCGAGGAACTTGGCCATATTCTGCCGTCATAACAGC
GTCAAGCCTAAAAAACCGGTATCTTCTCGACCAACAACACCTTTTCTAACCTCTTGCAACTTGTTATCTTCATTGTCCTGCGTCGCAGCAACAGTGGCAG
CGGCTTCCTGTTGGACGCTCGAGATCTCCGAGGCTTGTGCGGCGCTCACTTCGTCCGCAAAGTCGTCCAGCGCGTCTACAGCAGCGCAGAGAGGCGGTGA
GGGCGTGGGGAGGTGTCTAGATGCAGATCAACGCGTTTACCGTCCAGGAGGTCGTCCAGATCCACCTCCTCTTGCGTCTTGGGGTCGCTCTCCGCTTTGC
TCATCGT