Description :
From Genome Similarity Track
Location :
Scaffold_329:22132- 25219
Transcript NameFunction/comments
Phyke_g8449hypothetical protein

Sequence
3087 bases(100 bases per row)
AAAAAGGTTGACGTGAATAGTGTCTTCAGAAAGTAGCTCTGGATCGAAATACAGTGCGTGCCAACGCTGACGAATCGGAGATATGACTTTGTTCACGAAG
AAACTCCGTGCCGACTTCATTTCGTTCAACGGGATAGAGGCCTGAACAAGCGAGCCGCTAAGTCTGCAGAGTGAGCAGCAGTAATCAAAGCATTAGTCAA
TCTACAATCACACGCACAACGTCAGTACGTACTTGTCGTAGTTGACGTAAATCTGGAGATTAATGGGGTCAACCAGTACTCCACACCACGACAGATACCC
ACCGGATTCTTGGGTATCACACCGTCGGACCTCTTGCTCTCCGGGAGCAGCATCAAAATTTGCTTGGCTCTTTGCTAGGTTAACGAAACATCCGTATTCT
TCATTGCCCTCGTGCATCACCTTTAAGAACTTTTGGGCGCGTTTCAGATCTGTCGTGACGTAAAAGAAGTCGTCGGTGTATCGAAGCAGTTCTTCGTGTT
GACAGCAGGAAGTAGGCACGATGGACGGATCGCAAGGCTCGGGTAGGTGCTTGCGGAGTACTCTCCGCTCAAAGTGGGCATAGTAAATGTTGCATAGCGT
TGTCGACAGCACGGAGCCCTGCGGGATACCACATCGTTGAACGAACTCACGACCGTCCATTTGCACTACGTTCGTGAGCAAGTGTTCCTTCAGTAGACGC
AGAGCTTTCACTTTCGTCAAGTAGTCGTATATGACTCCATCGACAAATATTgcgtttttcttcttcgatTGAGCCGCGAGCTCGTCAAAACTGACTAAAG
CGCCAGACGGGTATGCAGGGCGCTCCATTTTGAAGAAAAATGAGGACAGCGGTGCTGATGCATCACTTGCTTCAATGGAACTGACTTGGTGGCCGACCCA
ATGTTTACGGATAAGGTATTCATCCTCACGCATTGCCTTTTTCAACACCTGGTAAAGTTTTCGCGGTCGAATGGTATCGAAGCAGCGCTCGATATCAACT
GTCACACAGTAGGCCCTGGGCCCACCTCCAGACGCACGTCGACGCTCAGCACATCGAGTACAAGAGGCAATATCATGAAAGAGCGGCTTCAGTCGCTTGT
AGATTTCGTCCAAATTTCGGACTGATGCTCCAAGAAGCCGCTTTGGCTGTCGATCCATCTCGAATGTCAAAACTCGGTGAACAGTTTCCATAGATCTGTT
CACGGAGACCGAGGCTTGGTCCACAGGTGCGGCTAGGTTCATCAGTGGACGAACCCCGGTTGCTTTTGGCAGTAGCCGTAACCGAGATGTAGCTAGCTGA
CGTTCAAGACTAACTGCTAGAGTTTGATCATTCGACGATTGAAGAATCCCTCCTTCCAAGTCATATAGAGCGAGAGTGCTACAGCATAGAGATACACCAT
TTAGCATTCTCACACCTCGAATTAAGTATGCAATACGCACTCTTACCTGATTACGTTCCAGACAGGCCGTTGGTAATATGCAATCTCATTTGCCATTCCT
TCAGCCTCTGTGACGTAAAACACACTCCGTAGCAGCGGGAAAACTAGATATGATATCACCCACCCCAGCAAGTCCTCGAATAATCTGTGACGCTTGTCTC
TTTCGTTTGGCGGGCTGAGTGCATGGAAAACAAAGTCATGAATCAGCTGGGTCACTTGATGTGTTACAGCAAAAGAACAAACAACCCGCACCAGAATGCC
GCATTAGCGTGGAGGTTCATCCACTCGACATTCGTAACCTGAAACTCATTGGCACACTGCATCGTAAAAATGCAATTAACTCATGGCATGATCCCAGCAT
AAATACCCCCATTTCCCCCTTAACTTAGATTGCTTACCTTCTTTAGCGAAAAGACATCAAACTTCCGAGAAGAAATAAGCTTGCGTAGCATCGCTTTCAC
ACATTTCCagttcttctttgtcttgcTGTCGCCCCATACACTTTTTGGCACAACTCTAGCAACCAGTTTACGCACAAGCCGGTTAATCTTTTTCTTAGGT
GTTGTAAACGCCAGCACCCCCTTGATATCCtctttgtgctgctgcaactttgCCAGGCCCGCACTTTTGCAAACTCTGATGTGACCTTCGACACCACTGT
TGAGTCTAttcttctgtttcttcctcGGTTGTACTGATTGATCCAAAGCAGTCCTTGACGGCACCACCGAGGCATGTGACAGCATTTCAATGGCTTCTTC
TCTTCGCTTACGCTTTTGATCACAGCTCGGTTCCTCGGTTTGGCTTAGATATCCATCATCCAGTGCCTTACGTACAATAGGTAGGATAAGCGGTTGTGAA
GACGCCTTTGCATTAGCTTTTCGTTCTGCGATCGTGTGCTTAATTTTGGGATTACCAGCCATAAATTCCCGAAAAGCAGGCGACAGAGGGATCAGCTTTC
TTGAGAGGTCTTCGACATCGCATGCCTTGAATCGTGCAACTAAGGACTGCACAGTCGGGATTAAATTAACCAGGCGCTTCGGCAGCCGCTTCTCCCCTGC
AATACCCGGGAATATTGATCGAAGCACTTTGGAAGCTTCACTTCGACTGACCAGCTCACCTGCCGTCGACATCTTGGATGATTTGACCAGTACGTGAGAG
CTTGCGAAGACACGATCTTTTTGAAAATGACGTGCATACATCACTTGGTTGATCGATACTTCTAACTTGTAAACAACATCAGGTGCGGGATTCTGCTGTG
TCTTTGCATTATTGCCAGCTATCAACGCAAGATCTTTACGCAGACTTTTCCCTGCAAGCTGGCATGATCACAAGGGCACACATATAAAATCCGTTTAATG
TGTTCGAACCAAGTATCCACATATTGTTCCCTCTAAATACCTGGATATAAGAGAGTCGAGCACCCTTTACTTGAGCAAAAATCGTATAATTCAGCAGGAG
GTGATTCATGAGATCGTCGCCCATGAGCTGGTGTAGAGACTCCCATAGCGGTTTTTTTAAAGTGGACACCAGCGTATTCGGATAGTAACACATGATCCCA
TTGGACTGCGTCACTCGATGACCAGAAGCTCCGGGAGTCACTTCTCGATAACCGAGCGTGAGGATATTCGCATCCTCCCAGTGACTT