Description :
From Genome Similarity Track
Location :
Scaffold_125:22131- 23705
Transcript NameFunction/comments
Albla_Nc14076570molecular chaperone DnaK putative

Sequence
1574 bases(100 bases per row)
TTTCGGCTTCTTGAACCATTCGCTCGATATCCGCATCGGACAAACCGCCACTTGATTGGATAATAATATTCTGCTCTTTTCCAGTGGCTTTATCTCTTGC
TGCAACATTCACGATACCGTTTGCGTCGATATCGAATGACACTTCAATTTGGGGCACACCACGTGGAGCAGGTGGTATTCCTACCAAATCAAAGTTTCCA
AGCGATTTGTTATCCGCAGCCATTTCTCGCTCGCCTTGCAACACCTTAATGCCAACTTGTGTCTGTGAGTCGGCAGCGGTAGAGAACACTTGCGATTTCT
TGGTTGGAATTGTTGTATTTCTTGGTATCAGTTTTGTAAATACACCACCCAGAGTCTCAATTCCAAGCGACAATGGGGTAACATCCAGCAACAAGATATC
TTTGACATCACCACGTAACACACCACCCTGAATGGCAGCTCCCATTGCTACCACTTCATCGGGATTCACACCTTTGGAAGGCTTCTTACCGAAGAATTCT
TCGACTGCTTGTTGGACTTTGGGCATTCGCGACATTCCACCCACTAAAATCACTTCATTGATGTCTTTTTTAGCCAATCCAGCGTCAGTCACACATTTGC
GGCACGGAGTAATGGTACGTTCGATGAGTTTCGAGACCAAATTTTCGAATGTTGAGCGAGTGATCTTCATATTGAGATGTTTGGGTCCACTTGCGTCAGC
GGTAATGAAAGGAAGACTGATGTCCGTTTGAGCCAATCCATCGAGTTCGCGTTTGGCTTTTTCAGCTGCTTCTCGTAGTCGCTGCATAGCCAACGTATCC
TTCGAAACATCGATGCCGGATTCTTGCTTGAATTTCGAGACCAAATGACGTAAGAGCTCTTCATCGAAATCTTCACCTCCCAATAACGTGTCGCCATTGG
TTGATTTCACTTCAAACACACCGCCCGATATTTCCAAAATTGATACATCAAATGTCCCACCTCCCAAATCAAATACTGCGATTACTTTACCATCGGCCTT
GTCCATTCCGTACGCTAATGCGGCAGCGGTGGGTTCATTGATGATACGTAAGACCTCTAATCCAGCGATTTTGCCTGCGTCTTTGGTAGCTTGACGTTGC
GAGTCGTTAAAGTACGCAGGGACGGTGATAACGGCTTGAGATACGGATTGGCCTAAAAAGCTGTCTGCGGTCTCTTTCATTTTCCCAAGTACCATCGACC
CGATTTGTGAAGGAGAGTACTTTTGTCCCTTTGTTTCGACCCACGCGTCTTTCCCATTGGAACCTGGTACGATTTTATAACTTACGACTTCTTTCACTTT
GTTGGTCTCATGATCGTTGTATTTTCGACCAATAAGACGCTTTACCGCATAGAATGTGCTCTCAGGATTGGTTACTGCTTGTCGTTTGGCTGGCATTCCC
ACCAATCGCTCTCCACCATCCAAAATAGCGACCACTGAGGGTGTAGTCCGAGCGCCCTCCGAGTTCTCAATCACACGCGGAGTCTTCCCGTCCATAGTCG
CCACACACGAATTGGTGGTACCGAGATCGATACCGATAACTGCTCCAGAACCGGCTGCATTCTGCGCCTGACGC