Description :
From Genome Similarity Track
Location :
Scaffold_306:22131- 23183
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_306-snap-gene-0.19Novel protein

Sequence
1052 bases(100 bases per row)
CCATTCGAGGAAAGCGCACTTGGTCAATACATAGGCGCCTCCGAcTtCAGTCTTGAGCATTGCACTgaaaaTACTGATCACAaGAAGCTGTGTGTGTTCG
TCGGCAAGATCAGAACAGTAGAAGCTGAGAAGAATCGACGGCACATGGCGGCGAATCATGAGTGAAACGTCCGCATCTTCTCTGACGCCACGTCTCAGTC
CATGAAGAAGCCACGATCGCTCTTGCTTGTACGTCTGCGGGGAGTGGCTGTTGAAGAGAGAGTAGAACATTGGGACATCACTCAGATCAATAGCAGGTCT
GGAGAGAAGGAAGTGGTTCAAGTGCGGGTACATAGCGTGGCCTGGACGACTGAGGATTGAAAGAGCATCATTGATGAAAACCGTAATCGCCGAAGAAACA
CCTTCTAGTGGCTCTTGAAGAGCGTTGCGAAGTCCCTCAAGCAGCAAGTGTACTTGGCGACCCGGTTTGAAATCagTGGACGCGTCAGCACTCAGCGCTT
CGTGCACgTGGGCCAAAATACCGTACGCGTACTCTCGAACATCGTCCGCATTTGAAGACACGGCTCGAACGACAACTCCCAAAATCCCGTGTTGGACCAT
GACACCTTCGGTCAGCGAGGATGACGCGACAAAAAAAGCCAACATCGGCAGCAAGTAAGACGGATCATATACCAGTGATCGAGTCTGCTCATCCAGACTG
TCCTCGgCTTCTTCCTCATCATCTTCtgTGTcGTCatcctcAAGAAGGTAATCATCACTCTTTACCGAAATAGCCCGGTTCAGAGGGAACGAATCTGTGG
TTaCGCGGAgtCGTGAGGGCTCCAGTCCTCCTCCAATTAGCCAGGCTGAGTCATCTATGAGGTCATTTCTCTTGGATCCACTCTGGCTTTCGGTATGAGT
AACAGATTGTCCAAAACGGTAGCCAAACTGGGACGGGAAAAtccccGCCACTGACTCGAACTCCTCCATCAGTCGGCGAATCAGTCGGTCAgcGAGAGAA
AGCGACATGTTGTACGCACCGAGCAACTGCTGAAAcACGTTTCGAGCATACA