Description :
From Genome Similarity Track
Location :
Scaffold_4:221279- 230609
Transcript NameFunction/comments
Phyca_LT153481213tRNA (guanineN(7))methyltransferase putative
Phyca_LT153413532tRNA (guanineN(7))methyltransferase putative
Phyca_LT153433876Ptype ATPase (PATPase) Superfamily putative

Sequence
9330 bases(100 bases per row)
atttgcaactaccgacaatgaaacttccgcgctagcttggagccaccatggccatttcattcgattgctcaagttccccttgtgcaatcttaggatatgg
tgaagaaacacaccaagaacagacgacgggcttccacgacggcgcagaatctacacatttctaccaaccgcccggaacgacgccatagtgaagccacaac
gtccaccaaaacaagcgagttaagttacactgagcctgtgatcgacaacgtcgagcttttggcacctcctcaaagattggagaaagaagtcgatgttaca
gcattggaagaaggtggttgtaaggatggcaaaaagacattcgcaatgatgtctcctcgtctcgatgcacaattaggtggctacactccagattgtggca
cgaaagagctcaagtatctctcctatgccaaagttttgcgtgaccggggtataactcatccaatgcgatactccaacactcgaatggatgcacgaggttt
tgcgatgccagagcgctaccctttgttttcaacggactttggtgctcactcgtttcaccacttacctacagattcggttgttttgagtcagtatggactg
ggaatcgctctctacttcaaatatctcaaggttataacgtggctcttcctcctgcttgtggtgatcagtgctcctactttaacagtttacattgtcggtg
gtggaacttccatggcagaactcactgctcttgcgcgacaaggactcccttctgttctgggtataaccagtatcggccatctcagtgaggccagtagtgt
ttgtgatcaagctattgaaaacacagagctgtcgctcacgtgctcggcaggtgagattggatttgtgaaggctgtttattcaacgtacaattctcaggga
agctgcacatgccctgaacgcaataaggtggctgaaggatctggtcaatgtcgtggtgatgcagagggatctgattgtcctctggatggagctggatgtt
tctggcgttcacccggtttcactgcagccttgttgttcctattcacgaaatgtagtaacgaagactccaaagtttgatgacatgcgaattcgagaaagtg
atggatgcggctctactagagctcaagaaattgtcgaaggactgtgtttaggcaagaaaagctgtgcacttaatgttagtgaggcgatcacgtatgtatg
ggagcctgacgtcaaatacggcacgaattgctcgaaaaccccgactactgttatggttgacagtgctaccaacatcacaaaagaggtttgcgaggttgaa
ctcaatgacgatagtgactattccatgtgtgaacctgataagccccgagcgttgattgtctatgggcggtgctttaccacccacatcgacttatcgggtg
catggaacctcaagatcatcggctggaactccattagcgtaaggttttgtaaaattgttttggttttctaggtattctaagtcgaggttttgggatgcag
cgacgcgaattcttaggactcgcagttggatgcgatatcgtctgcagtctcgcgttctttggggttgtcgtgtggctccgacgcaaggaaaaggaagctg
taaagcgcattactcagaatcaggtcaaagctctcgattacacagtccagctcgtgcacttaccgcaccatgacgatctcaacttactacgacaggaggt
gagctgtcgaaagcatgttttagtatttttgctaactcacaatttgtggaattcatagattcgtttacacttagaagctgtgctgagtaattccccgcca
ttcgcagtggacatggatcggattcgtgttgccgacattcaattcggtaaaagtgcatcacgtcccttacacctactcagacgccgaggtgcagttgtgc
gtcgtcttgaaattgcccaacagcgtcacgaaaagctacagctcttacatggacgactagatacacaagtgtacgttagacgtgagaagcgtcatctaca
agctatccacaacttggaggtaaaattgcatcgattcaacgtgaaactggagcaatggcacgtccatcacaaaagacacaatatttcgcaagctgtgact
gctttcgtgacatttgaggaagaggaaggtttccaccgctgcctgcaggaatatccagatctgggttggctccaccgcctctttcagcctcactacaagc
gcctccatggtaaaagacttcgattccgtccagctccagacccaaccgatatcatttgggaaaacctgcatcacccgttttttgaaagagtctgtcggca
actggtacgttgataactgcattgaccattctttttcgattgtctaaatattgggaatgtgaacggtatgcagattgtggcgctaattacgctagctgtt
ttgttcctgagtttcgtgttgatttttctggcgaaagagcagaaaagtaagctggaaaggcagtttggacgaccaaccagttgccccactcaagttccca
agacggatgtcgttcaagatgaactaaacaaagcctcgcagcgtgtgccgtacaaagctctcatcgaatgctactgcaagaattttctcgtcaaccagta
agtcacctcgctttcggatatcttgtacttatctagcctaaaaactgctttcttcacagctcttttcgaagtatgatgtacgaaagcttcgacaacccgg
aaacaggggagaacgacctgctgtgtcggtcttgggctacaacattcgtgacaacccaaattttgtctattgcttcagttctattggttgtggctgtgaa
cctgattctagctcgtattctcaatggccttgtagccttggagaagcaccacacccagtccagtctggttgtatcccgtgttacgaaaattttccttgct
caattttgcaatacggcattgctcatgttggttatcaatgctaatgcaaactacttctcgaaatcggctattgtgtcggagactggaacctccaacgaag
gaatttcactaggagcgttgcagatcctggacggagagtactcggacttttcggcggactggtacaatgacgttggtgtggcactcatgctcactatgat
catcaactcgttcagtacgcatgcctatgtattggcaaactacatcatgctcaaggcccgccgttttatcgatcgaggttattcttttgaccactctttg
acaaagcaagacactcagcgagacctcgaagcgctctaccgtggaccaaaattcgatctcgctgcacgttacgctcaatctctcaccacgatcttcatca
catacatggtaagtagtcattggatgcgtaacatagactcttacttatctgttctgcgtagttctcggcaggcatgccactgcttcactttatcggcttt
ggggcgatgatcatgacgtattgggccgacaaattcagtaagtgttttgacatttttcttcagttttgagcctcacctataacaatttggaaattgtaaa
taagcagcttttcttcgcattgctcgatctccgcctcgttacgatagcaagttggctacagccgcaggagctttactcccgtatgcagtattgatgcact
gcgtcattgccatgtggatgttctcgaacgaccgcatcttcgagtctgaaaacgacaaagagttcgaacaggccactatgaacagcacgtacagtcctgg
agacgggattccactgttcgatggaactcgtcgagggcagttgatttcccgcgtgacacgccctcaagttgtaattctcttcgccttcttcgtcgctggc
tgtgcgatcgtggtcatacgaactttgctcttcgagtaccttccagctctggtccgaagtatcctcccagcccttgctcgtttactggaaaaacctcgtg
ttccgaaaggaatccccaactattttgacggtatgtacagcgcagtgctcacttgtggtttgagtatcttctaacttttgtcatctcagccatttcaacg
gcttgtctgcaggaaaaagttgctacaggcggctcacaacttctgcggccggatctgcgtgccaagtacgaacgtgctctgctccaccgcctctcacacg
aagaaaccacgctgaaaaagagcgccaaacacccgcaatccgcagaccgctacaaccaggcaaactggatcgtcggctgtcattcctatggtatgtctgg
ctcccaatatcccctttggccaataactaatgatttttttgaacagccatcagcgacaacaaggaatacgtcgccaaactcgccattgactcacaactct
ccgaagaaatcctggatcaaatattctaaacactggactggtatggtacatgctcgacgtttattacctgtttgtaagaaatccgcatcttcttgaactg
ttgagatagtctagtgcagcgtcttaggggacggagttgatccgtcagcagtggaagacgatggcgactgcacacgcaggccaatgtctgaaagatctga
cctctgccctgcacgagtctgtggacgcgtactggtattgctactgcggtaaatacccaacgccatctccgtctcgcctggacagtgagagaaagcaaaa
ccagtattgcgacgtacaaggcgtggtgaatccatcaccacagcggcatcttcgcccttcgccagacgattccattcacgcattaagtgcgacggctcgg
ggtagaacagcacgcgtccggccttggcgatgtagttcggtaaaatggcaacgatcacagacagcagcagaccgagccaaaaccaggcttcacgcacaag
ctggctgaccactccaaagcccacttctgtgtcgtaaaaatcggccttcgtccatccgaatacagcacagaagaacgctgtaaacaggtagtagaacacc
actgtgccgaaagtagaaaccacgttggttcgcgtccagttactcgtcatgagcgatacttgcaccgttgaagctgtaatcaggtacgtgtaagaggcca
caccgtttgcccaaaggcccaagtcgcgcttatcgaactgcagtgtggacgatccacttgagaaataccacacaatcgaaccattggagaagaaaggcac
tgcgtataccacgtaggcatgccacgcaccaagtacacaccagccaaagaaggacagccagttgaaagatcggttcttcaggccgttcacgtacagtgtc
gggtactgcatcagcacagccggagacacgtcttggttgtacatggcaatcaccacgataggaattgtcgtgaatagcgcgttgtaaagcgtgaagaaga
tgctgaagtacatgagcaaaccactgtacatcgtctccatcgccaagaaaaagttcgacaaggacaatgccacgttcttcatgaacgagaacaggatgag
cttggaaatccgcttgtaactgtagttgccgtgcaccagcaacagacgctttaagtactggaattctgcgatggagtagtcactggatagaacagcttga
cgcccttccttgccgctgatgccgacaccaacgttggctgcctgaatcatcggcacatcgttggcaccgtcaccaatggcaagtgtaatgttacctggtg
agaacatgagcgtgggttccgtaaccagtttgaccaccgacgccttctgggatggggaacaacgacagcagatgaccgatttacactgcgtagcaacagc
caagaagaggtacttgatatcatcatccagcaccaacgcaagggttttgccatcgatcaccatggcaaactccagctcctcgtctacgtaatcgccactg
ctcatgctacccgtcccacccgtcatattgtcagtcttcggcttaaagtcatgatcacacaaatcgcgatcgaagctgttctccgaaatatcacaattcg
gtgcggcgggataaacctcgtcgtaatgggcaggactatcagtcggcgtctcagcgccagcatgttcacgtcttggcaagcgcctcctctttttccgggc
ttccgcttcttcgtctcggccaaccagcgcaagttttacaagatcccacagatacaaaatggccctcttcagagcttcccacagcacactgactgctgaa
gacgtttcatctgacccccacttgtcctcgacaaggtcgacgtacaattcctctagtcttgtacgtagagatcccttgtcgcgttggcctaaaacgatca
catccatattatcatcaatcacatgcgatgacatgccgatgctaagcgcagtttccttcttgtcgccggtgagcacccagaacttaatgccagccttgcg
taaagcacaaatggattcctccacaccatcttgcagtcggtcttcgatggctgtcgcgccgagcaaagtcaactcgacctcaataatggctgaaaccttg
gcaatcttagcggctcgcccttccagggaaaattccgcctgccggtacagttggttccactggtcatattcctcctgagtaagacgccgcatagcagtag
tcaaagttcgaaggccttccgacgcatactcctgaagatgaccacgagtcacgtgagctacaccttgaggctgggactttgatagtaagtcaaaaataat
atcatcagcacccttgcagtagagtacgatacttccgtcagggaatcgcactataactgacattcgcttcctgtcgctgttaaattccagtacattcagg
atttcaaacgacatcggccttccttggataagtgtgttgcacattggaccgtcacgggactcaagcacgtagcctaggtcagcggcagctagcacaagag
cctcctcatcaggagaagacgcgttgtacttgatcgttgggttcgtagccgagcaggagtcactacttgatgtcggcgacgttggaacgttgttttccgg
gatcaccgtgttgcaaatcgtaagtaacagtaagaagtcgtgaatctcctttttcgtcgagtggtttgagttcaatcgtgccagtaatcgcccatcatta
aaccgtgtgcctggtcgcccaggctttgcggggtctacctcaatgtcgttgtacctgaggcctccaatagtgcacttcgcaaagatcatctcattacacg
tgagcgtacctgtcttgtccgagaaaatgtactgaatctgtccgagatcttcgttaatgttgctgttgcgaacctgtgcaggtgtatccgtcttggagtc
gtacatttccagatcattttcgatgtaacgcgcgtgaacgaaccgaacgccttccatcgtcacgtacatcgaaagcgggataaggttgttgaacaagatc
acgtaactcaagaaaatgtagccgttcgagtcttcctgaatgtaccacggtgttttctcatctgccagatccaaattccagttgttgttgcctagcgtgc
aggcgatcgaaatcccgaaaagcagcatcagaacaagcacgaacatggtgtccaaggtcttctccacaaagctacgtttcagcggaacggcaacagagtt
catttgaacttttgtctccttacccgtgtagatcacaagtccaagcgtccactcggcgttacgactttcgcttccacgtaaaatcaaattgtccatggtc
aagctggtctcgttatcttccttgtcggtatccgtgacagcttcatctgtaatttttcccagtcttaaaacaccgtcgaagtagaacaggtccttgttgg
gcacgtcgcactcaacttcgagcttgtatcggtccaggatttcatcagcagtcaagaaatgcttcgtgcagctcgctacctgtcggattttgaggttcgt
ttcaccatcaaggttggccgtctccacgtagcatcttccatcaggtctgctagtggccagtagcacacaatccgcaggaacctgatcaccgtccttcagt
agcagcacgtctcccacttcaatatcctgccacgtgccgtcaatgtgcatcacttcgtccaaaacgtcacgacgaacaatgtgcgccgccctggaattga
ccatagcatcccctttttgtcggcgaagatcctcgctcacatccttcagcgccgaggtcgcaaacacgatcagcaacggcgtcagactggccacgggact
cacaggcgagaagtcgaaaaaacacagcgccaccacaatggtcgtgtagagattcgccaatcgactgaactgcattttaaggaacacgaacaggaagttg
tagtacgtgtacttgctcgtgatcatgaggttagagcagaacacgggcgcctcttcctgtgcttctgcttctttcctccgctggttcttcgttttcattg
catcaggtagcgtcagtggcacacctgactgactgcgtcgtaacctgttgttcgggacgccaggacccaccacaatcttccgacgagctgaaggtcctac
gtcctcatccatctccgctgacgggttaatagaaagcgtctgatggagagaattaacccgctgaggagacggcatcatcgttgctaaagcagctcggtca
cactctcgttggttctgcactgccttgacaatgcgtcgaagcttccagccgtacatgaagcccgcgatattgagcatcgtcagcaggattgaaaagaaac
cctgcatgagcacggaagtaccactactgacactgttgagcttgccgttgtagcccttgtagtaccaaatgacatcaacgagcagcgtaagctgcatgcc
aattttgtaactgagtaggaacttgggcacgaggaacttggtgccatgccaacccagtaccaacgtgatatacaggataagcaccggcagtgtagcttgg
aagctcaaacccaggataatggggaagatacgaagcgagttgatgatggtttgggacacaatcgtaaacttcagacgacgtcgtgtctggtagatggtca
tacccttgaggaagcagaaaacctgctcaaaaagattccacagtttagtctctgcattgggttttgtatcggacgccacggagtccgccatgctgtcagc
tcgataccgcagcgagatgatgttgcgctgctcctcttcattggggacgcctgtgaaggtgttgacacgccgtaagttcttgtgggactgcgacgtcggc
gcctgcgtggcggaggacggaggcgccgcgctgtctgtggacgcctgcatgtccagcgtgtactccgtagcactgtcagacggcgagggaaccgcgaact
cgacgcgcatctcgtctgtggggccgttggcttatgtgggacagcaaaatacactcgcgcagcgccacgccgtcggcctattctaaggtgttggaatgaa
gagagattccgcgctggcttgagaagaaga