Description :
From Genome Similarity Track
Location :
Scaffold_280:22126- 24283
Transcript NameFunction/comments
Phyta_totarag6625myosin-like protein

Sequence
2157 bases(100 bases per row)
TCACGTTATGCCATTCTCAGCACCTCCAGTTAGTGACTccaacggcaacgacaacTCAGGAACATTACTCCGAGCCAGAACTAATCGCCTAAGTTTAGAC
CCCACACTCCACTGTCGCCGCCACGTGAACCCTCATCCGCAGCTCCATAACATCTCTCCAAGTCCACTGCGTAAATTTCCGCCATAATCGTTCACTCCGC
TGCTGTCCATCTGGAGTCCCATCTCCTTCAACCCATTTACAATCGCACCAGGTCCTTATCGGTCGCCCCGCTTGGTCCGTAAATCCAGGTTTTCCTCTAA
TTTCCTGCCCGAGGTTTTATCCCCCAGCCACTCGACATGCCGACCTCACGCGCTCCCCGCATTTTCACACGCAGATCGGCAGGCGATAGCGCAGTGGGCG
CTCATCTCATCGACTCGGTCTCAGTTGGACGCCATGCAGCGGCGCGGCGGGGGCACCCGCAAGgagcggctgctgcgcgccaagatgaagaagaagatgc
aggaTGAGGACAGCGCGGCCAACGGCGCGGGCGCCAACACGTTTGAGGACATTTTGCAGATGTCGGACCTGTCGgagcagtcgctgctggagaaccTGCG
CAGACGCTACGAGCACGAGCTCATCTACACGTACGTGGGCTCCATCCTTATCGCCATCAACCCGTACAGGCAGCTAGACGCCGCCTACAGCGAGCGCAAG
ATGACCGAGTACTACGGCAAGGCCATGGGCATGCTGCCCCCGCACGTGTTCGCGCTGGCCGATCACGCCTACACGCAGCTCATCCAGGGCGGCGCGCTGG
ACCCGGCAAACCAGAGCATCATCATCAGTGGCGAGAGCGGCTCGGGCAAGACGGAGACCACCAAGATCATTATGCAGTACTTGGCCCGAGCCACGAGCTA
CAGGAAGGCCACGTCGGACGGAGAAGGCGGTCCGGTAGTCGAGACGGCCAATAGCGGCATGTCTGGAGCTCTGggcaagctggaggagcgcgtgctggag
agCAACCCGCTGCTCGAGTCTTTTGGCAATGCCAAGACACTGAGGAACGACAATTCCAGTCGCTTCGGCAAGTTCATCGAGATCCAGTTCAACCACCACG
GGAAAATTGTAGGCGCGCAGATTTTGAACTTTTTACTCGAGAAGACACGCATTGTGTCGCAAAGTCTGGGGGAGAGGAACTACCACATCTTCTACCAGTT
GCTGGCTGGAGCGGACAATGCACTGAGGGAACGACTGCAGCTAAAGACGCCGCTTGAGTACGAATATCTGAGAAAGAGCGAGTGCTTCAACATCCACGAG
TGTGACGATGCCAAGGAGTTTTTGACCACCAAGAGATGTATGGAGACCATCGGCATCACGGAAGAGCGCCAGGAGATGGTGTTCGAACTGCTGGCcgctg
tgctgcagctcggcaACTTGCACTTTGCCATGGAGAACGACACGTGCGTGACTGTGGGAGACAACTCGGCGAACGGGTTGAAGCTCGTGGCGTCGTGGCT
GAAGGTGAGCGAGGACGCACTGTCCAAGGCGCTGCTCACTCGCCAGCTTTATGTGGGAGGCAAGGTCattgtgcagcaacagaacTCGGAGCAGGTGCGT
GACAAGCGTGATGCGCTTGCCAAGGGCATCTACTCGTCGCTATTCCTGTGGCTCGTGTCCGAGCTGAACCGCACCATCTCGCGCACCCAGGACAAGTGGG
GCTTCATCGGTGTGCTGGATATCTACGGCTTCGAGAAGTTCGAGTGGAACACGTTCGAGCAGCTATGCATCAACTACGCCAacgagaagctccagcgaca
cTTCAACCAGCACATGCTGGAGGTCGAGCAGAACGACTATGCCAAGGAGGGGATCGACTGGAAGCACATCGACTTCGAGGACAACCAGGAGTGCCTTGAT
CTGATTGAGAGCAAGGTGAACGGCAAACCGGGCATTTTCATTTCGCTGGACGACAACTGGCGCCtcaaaggagaagaagcgaacAAGAAGTTCGTGTCCA
ACTTGCACAACTCCTTTGGTCGCACGTCTAGTGGAcactcgagcagcaagaacaagttcTACGTGCACCCGAAGATGGACGCAGACTTGCACTTCGGTAT
CAAGCACTACGCCGGCGAGGTGATCTACGATGCAAGCGGCTTcaacgacaagaacaa