Description :
From Genome Similarity Track
Location :
Scaffold_341:22126- 24208
Sequence
2082 bases(100 bases per row)
GGATTATGTGCTCATTGTGTTGTGAGACGACGGAAAAGGACGTGTCTACGCTTAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CAAGAGTGGTACAAGGTCCAATTGAGGCGGATGCGCTCAAAAAGTTTTGGATATGTGCTCATGTGTGCGAGACGACAGAAAAGGACGCGTCGATGCTTGG
ACGGTCCAATGGGATGTCATGGGTTTTTAGCCACCCCCCCGCCACGCGTACTCGTAAAAGTCCACACAAGGGTCTACGAGTGGATTTTTCATCATTTCTA
AACTGGATAGAAATGCCACGTCGCCTGCGTCATAATTAACAACCCCAGCCCTGTCATCAAGTGATACTGTGACGTCGACGATGTCAGTGGGAGATCGAGT
TTGCTGCCGCGCGAGAGTCCAGAGGCCCAGACTCAGCGCTCCCACCAGCACAAAGGGCCACACACTGCGGTGGCGGTCAAGATGAGGCTGACCGCTATTG
TCGTCAGTGATGAGCAGCGGCGTGATCTCGTCTACGGGACGAGCCATCGCTTTGTTTGATCTGGATAAGATCGCTGAATGAGGCGCTGATAAATTGTTCT
GTTAAATAATGCTTTAAACAGCATTTCTAAATATGAGATACAAATGACTAATTACCAAGAAGATTCGCGGTAAAAACGACATATTGTGTAGAACATGTCC
TCGAAGTTGACGGTCGAAATATACAGTAGTAGAGCATGCATGACTGCATAAAATGAAATGTAACCGCAGCAATTTGCACTCGATGAGTATTGATTCTTGC
AGTTTTTACGAGTACGTTGTTACATCGTTGATGTATTTCTTGCAAAAAAGTATCGCTTTCCGAAAACTGTACATCCGTTAAAAAATGGCGTAGAAATACT
AAGGAGTGTCATTAGCTGTGGAGGGGACTATGTAGCGAAGGTACCCGAACTCCTTTGTCAGAGGAAGACTTATACACCCGTAGAGGTCTCTTAGTGTATT
AAACTAAACGGGTATAAACCTAAATGGCCTCAAGTCTTTACGGACTTAATGTAACGGAGTTACACAAATGGTTGTGATAACCAGGTACATTGGTGTGGTA
CACACAGAAAGAGATCAGTATCACTGATAAGGCGTACTTCTGTATCACATACGCTAAGCGATAATACTGTACCATATCGGTTACGGTTAGAGGATATCTA
TCGTAATAGGGTCTTCATAGAGACGACGTAGTTCTGGTGTGATACACAAGAAGAACTACCATGAGGACTATTCGATTAGGTAGCATAGTTTCAAGGTTCA
AGATGTAAGTGAGGTTTATTATCGCTACAAATCAGTAAATATATTCAGTTCCCCTTTTGATCAGTTTCAGACACATGTCTTGCTAAGATGTCTATGGTCG
TAAGAGTTAAGTGCCTGAGTTAAGGCTAATTACTCTTGGGCATTAGTGCCACGTGATTCCTTGGAGTCGTAGTCCCCTGAACCAGGACTAGAAGCTAAAG
AGCTCGTACATACACTTAGACTTAAGTCTCACTAAGTCTGTAAGACTTGAGACCCTTTAAGTTAATACCCGCTTAGTTGATATACTACGAGACTCTACAA
GTCTAGAAGTCTTCCTCTGACAAAGGAGTAAGGGTAGCTCCGCTACACTTGGTAGCACTTGTAGTCAATCTACACCTGATTCTGTTAAAGTCTGTTCCTC
TTTAAAGATGGACACAAAGGTAGACCTCTCTGAGGCCCAAGGATTAGCGCTGGAGAAACTCAGAGCGCTAGTCGGGAACGAACAAGTGGATTTAATCCTC
GCACAAGGTCCTGACGTATTCGTGCACGTCTTGACGCTTTTATGCAGTTTGAGTCCACATTAATTTGTGCAGTACACGACCA