Description :
From Genome Similarity Track
Location :
contig_27:221205- 223373
Transcript NameFunction/comments
g7305.t1hypothetical protein

Sequence
2168 bases(100 bases per row)
GAGCTCGCTGTGAATGAGATCGCACTGTGGGATGCAAACGACATGAGCTCACTTGGGGAGCGGTGGAAATTCCAAGGGCACTTCGACCCCAATTTAATCA
TTACGGGGATCGGATTGTTGCGCTCGACGCCCGCCCCACTGAAGAAGATGAATTGTCAGGTCTCCCGGTCCCGGTTAAAGGCGCAATCGTGCTAGATATT
GCGACAGGAGATGTGCTGTGCGACTTGAATGACGCGATGCGCTCTAATGATTATGGTGCAGAGACAAACTGCTGCTTCTCAGCCTGTGACGGCACCATTC
TAACGGATGGTATGCTTTGGGATGCACGTATTCCTACACGTGCACTGTACAAGTTTGACAAACTGTCCAACGTTGGTTGCGGGTTCTTCCATCCTAATGG
TAACGAGGTGATTGTGAACTCGGCCGTGTGGGACCTCCGTACATACAGACTGCTGCGCATGGTTCCAGCGTTGGATAAGTGCTGTATCAAGTTCAGTCCT
TCGGGCAGTGTGCTCTTTGCATATTATCCGTACGAAGGGGTAAGTCCGAGCGTGCTTTAGCGACTTTTGTTATGTAATCTCCGACTGATTCATTGTGTGA
ACAGGGCGACTACCTGCCGATCCGGAAGAGCAAGCTCAAGTCTTGGTTCCGAGTACTGGATGCGCGTGACTACAAAGATATTACGACGATTGATTTGGGT
CATCCCGTGTTTGATCTCAGTTTGAACACGAAGAGCACGCTGCTATCTATCGTGGAGGGACGATACTTGGAAGCTGGGGATGTCGATGACAATGACTCCA
TTTGCCGTCTATATGATGTGGGGCGCAAGCGTCCGGCTGAAGATGATTCGGATGCAGAAAACGGCGAGGATGATTCAGATACCTTAGACGATGACGAGTA
CGATGACGAAAACTACAGTGATGAAGAGGATGAAGTGGAGGATGACGAGGAGATGGAAAATGAGGAAGAGGAGACATCCGATTCGAACTCGGAAAATGTT
GGAAGCTCAGAAGAGGAGGAGGAGGAGGGAGAAGAAGAAAGCAGCGATAGTGATGAAGATGCCGCAGCACACATTCTTGCCGTTGAGGATGATAGTGGCG
GCGACGAAGACGGCAATGGGTCGATTCTGTCGACTCATGATCTGGGCTATTTATTAGATCTCCCCGATACAACGTACTATGAGGTGCATGGTCAATATTC
GAGCGACGAAGACGACGCTGAAGAAGACGAGTAGTTCTGTGAGCACGATATAGTTTTTCTGTACAGGTAATACCACAGACTAAAACACTAAAAGTATGCT
GCTGGTGTGTGCAGATTGGCCGCGGCTTGGAAGTGTTGCTCCCAATTTATCCACGAGAAGAGGCTGAAACGACAGCGGTTCATTACCTGTTACCGCTGTT
GGCACGGCGGACGTATCACCATGGCGACCAAACCCGAGGTGGATGAACTACTGGGAGATAAGCCTGTACTGCTAAAGCGGAAAGACTTTCTCGGGACGGA
GAAGGCGGCTCAAAGCCACCCCAACAGGACGTACTACTACCGACAGCCGACGGACCTCCAGCATGTGATTGATACGTCGACGAGCCGCCTTGTTCACGAA
CCGAAAGACGCCAAGGTATTACTAGCACGCGGACAAGCGCTTTTCAAGCAAGCTAACTACGATCAAACTGTTCAAGATCTCAGCGAGGTTGTGGCACTTG
ATAGCACCAACGCTGCAGCATTTTACACTCGTGGGCTGGCGTACTCGAAGCTGGATAAAGTGGAGCTGGCTATACGCGATTTCTCACGAACCCTGCAGAT
AAACCCAGAACATGTCAACGCTGCCTACGCTCGTGCGTCCTGCTACAACTCACAGGGCGACTTTGTACGAGCGATCGACGATTACAATTTTGCGTTGCTG
AAGGACAAGAAGCTGAAGCTCCAACAAAAGCATCAACAGGAGCTCCATCGAACAGCAACGTTGTCACGACAGCAACTTCAGCGGCAAAGGCAGCAGCAAG
ATGAAAGCACCAGTAACGCGTTCACTTTCTCTCGTCGAGGGATGAAAACAAACGTAAATTCTGAGACGACGACGTCCGCATCGCATGGAGGAAATAACAA
TAACGGAGATAGTGGGTCACGTCAAGAAGAAAAGGCTCTACCAACGTCTTCCGACTCTCGATTACAGA