Description :
From Genome Similarity Track
Location :
Scaffold_208:2212- 5586
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_208-snap-gene-0.23Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_208-snap-gene-0.13DNA ligase

Sequence
3374 bases(100 bases per row)
AGTAGCCGATGGACTTGACGTTNNNNNNNNNNNNNNNNNNNNNNTGACTGAAGGAAGAGCGGTGCCAGTGATTTCGAGTGCTGCATTGCCCACGAGAATT
CGGTGCGCAAAAGACCGCAGATTTGGCAACCTTGAGGAAAGTTACGCGCTTTGCAGATACGAAAGTGGCGCAAAAGATGCTTGGCCTGAGAGCAAGACGA
GTGGCATTGACCATCGGCCAAGAAACACTCCTGACAATGGTCAAGGACGCCTCGAGCGATACTGCAGTTCTGTACGCTGCATTTACTGTCACCCTTGCAG
CATTCTCGAGCATGGAGAAGTAGCGCAAGTCGACCTGCTAGATCTTTCGCATCGTAGTCACTCAACGCTTGCTTGGTGACGCGGCTCTGGAGAGATGGCA
AGCGGGGCAGAGGAGCGTTGCCACCCCTGTGCAGTTGCTCTACTGACAACGCGTCTCTTGACTTGAGCTCGATGGACGCTCGTCTGCTCTCCGACGGACT
CAATTGAGGTGGAGCAAACTGAATGCGAGGCAGATCTGTCGGTGTGAGTGGCAGCATTGGTAGCCGAAAGCTTTCGGTGCTACTGTTTGATCCGGAGAAG
GCGATTGTGCTCAGATTTGGTCGGAGAACGTTCATCGTTGAGCGCACAGGTGGCAGCTTTGCTGTTTTCATGGAGACGTCTTGGCTCTGGGAAACAATCG
AACTCGTGCATGACGTGGTTTTGCTCATCGCCATTGTGTCCTTGGGTCAGTATCTTTGTTTCGTTTCTTGGTCACAGGGTGAAAGTTGGAATGAGAAGCA
ACTTGCTTGCCTCAATTTCTAAATGACCACATACACTAGCATGGAGCACAACGAGTCTCTGGACACGACAAGATCCACAGATGGGGCTTCACTTTCTCTC
TTTTTTTTTCCATATCCGGTACTCTCTTCCTCGCTTTTGCATGATTATCTGTCGACTAGATCCCACACGCTTCTAATCAGCTGGTATGTATGATAGTATG
TATGTAGTATATTGAATTAACGTTGACCATTTCTACGGACATGTGGCTCTTTGAACAACTCTTTTACAGAAGAAAAGGTGCATCCCATCCTTTGGAGCTC
CTCGACTGTCCTCAAGAGACACACTCATAATATGATCACACACTTACATTCGTGCTGCTCTGGACTGAGAAAAGATGTCAACGCTTTTTCACTACTTCGT
TGGTCAACACAATGACTCTGCTGGCCACCAGCTGGTGCAAAATGGTTGTGGGCAGAGCGTCCTCATTCATGGCTAACACCCCTCAGATCGTTGAGGTAAT
GCCTTACAAGGGTCGCAACACCAGCCGGCACATTGAACTCATGGAGACGACTAGGGAAAAGCGCGCGTAGTAGAGATTGCCCGTTCGCAAGTGCTGCATA
TGTCGTCGTTAGTGCGAATGTGTGGGCTCGATTTGCGCAATGGTATATAAGCATCCTTGACACCAGCGCTACACTACTGCTGGTATTCTAGTAGTATTCA
GCTGGGAGCGTGACTGTGTTGGTAGAGAGAGACAGCTCGTGTCGACAGGAGCATCAAATGATTGGTGTCCGCCGTTGTCGTGCTTCAGAGTTCCGTTCGC
ATTAGAACACGTTCCTCGATGGCAGATAGTGCGATGGGTACGTCCAGTATACACTGTATCAATAAGCTGTAAGCCATCGACTGCGGCGTGTTCATTCTGA
TCGGCAAAGACGTGGGATGTCCAAATAGAAATGTCTATGCAACGTAAAGACTTGGCTTTTGTGATCGCTGTCGTACCCATTCCATGGCCAAGGAAACGAA
CAGTGGCATCAATGAAACGGCAAAGTCGATTGTGACTGCTTGCTTCCGCTCTCTGTCTCCACGGGCCCGTGGCGCAGTAACCACAGTAGCGCGATTGTCA
TAGCATTACGCTCCGCGCCAAGTCGAAAAGCCCACATGAAACCTTGAAGGCGTCTCCTCTACGAGTACTATTGCAAAATGAGGCCACATGGAACGGAGCT
CGTGCGCAGAAACAGGGCAATTGCGTTATGCTGAACTCTCTTTCCCTGACTCTTTGCGTATCCGGATAGTGTATGGACAGTATATCATCCGAATCCGAAC
TTAGGCGAAGCCAGTTAATATGGCGAATGTGCAATCTCAACAACACGCGCGACAAATGAAAAGCGGACGCGAACGAAATGGCGCGCATGTACTGCAGTCG
CCTCTGAGTGCGCGCCATGGCAGCTGCAAACGTGCATGCGTGTATGTGTTAGTATGTGTGAGTGTATGTGAACGTGTGTGCGAATGTGGCTCATGCTACT
TGCCCCACACTCCTCGTGGGCATTAACGAGCGGTTGATATTTTTAGTCGTGGAGCTATTCCGCAACCGTTATGTGTGTGTGCGCGCCTGTGAGGAGGGAA
GCGCCCGTATAACATATTCACCACGAGTCTGCGTGAATAGAGCATGCGCCGTGGGGGAGCAGGGGTAGTGGTGAGCAGTACGGNNNNNNNNNNNNNNNNN
GGAGCACGCGCGAGATCCGACATGGCGCGGCGCATGAGCCATGAGGTACGCAGGTTGACAGGACGTCCAGTTGAGCAAATGGATCATAACGCTGTGTGTT
TATATATGTGAGTTGTGCTTTAGACTCGTCCTGCGTCTTGTAGCAACACGCGCAGTGAACAGCGGCATCTGCTCGTCGAGCTGGAATTGGACGACTCCGT
GATGCTCGCNNNNNNNNNNNNNNNNNNNNNATGCGTACACCCGCGGCAGTCTCCAACAGCTCTGCAACCTTCAGTCAACCGCGAGGCACGTCGACGACGA
CGAGCCTCTGCAGAGGACGCCGTGTATGTTAGCAATGCGTGTGATCCGCATCCGCATCCTGCATATGATGCCAACTATGACGATGATCTGCCAAGTCCAG
TTGGTGCAAATTTCCAGCGTCCTTATTCGGCAACGCGGTCGTCATCGGCTCGATCATTGGCAGCATATGAGCACGCGATGGCTCGTTCACAGTCTCAGCC
AGGTTACACCACGTATCAGGACAGCGCGACGGTACACCAGGCGCAGCAGAATCGTGTCAAGAAGCTCTCGAGTCCGTACAAGTTGAAGCGAACCGTGCTC
AGCAGTCGATATCCACAAGAACCAGTGTCTGCTTCTGGTGGAGCCACCGACAGCCGACGGCCTAGTTCTCGATATACAGCGCCAAGTGACTCTCCGTTAT
TGTTGATCTCGAGTGCACTGCGACAGAACATGCAACTGCGAGATCAGCTTCTGAGTCAATTACACCATGAAATTGCCAATAGCTCCTCACGGCATCACCC
AGCGACATTGCAACCACATTTCGTGAAAATGCTCAATAAACTGCGTAGTTTGTCGTTGTCGATCGTGGAGATGC