Description :
From Genome Similarity Track
Location :
Scaffold_212:22117- 24387
Sequence
2270 bases(100 bases per row)
TTACCTCCTGATAGAGGTGTACGTCATGAAATTGACCTAGTTCCAGGAACTAAATACTGAGTAACACGGCAGTGGCCATTACCTAAGGAACAGTGTGACG
TCATTGACGATTTCTTTCATGATAAGAAGGCGGCGGGAATATTGCGGGAGAGTAAGTCTCCTCATTCCACACCTACATTTCGTGTCAAAAAGTCTAATGG
CAAGTGGCGCATTGTGCACGCTTATAATAAGCTAAATGCTGCCACTATCCCGGCTCAGACACCAATCCCCAGAAAGGATGTACTTCAGAACAATATGGTG
GGATATACATTGTACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGCTGCTCATACGAGCAAGCGATATTCCTCTAACAGCGGTTAGTACCACGAGCG
GTATGCTCTGGGAGTGGCTCGTTATGCCACAAGGGCTGTCAAATGCCCCGGCTACTTTTAACCGTCTGGTGACGCAACTATTCAGACCTCATCGAGGCTA
TGCACAAACGTACTTTGACGACATCTTTGTCCATTGTCGTGCAACGAACGGTCGATCTGATGTGGATAATCACATTGATCGTTTACGAGCGGTGCTCGAG
TGCATGCGTACGAATAAATTGTATGCAAATGCATCTAAGTGCATCTTTGGTGCAGAAGAGATTCCCTTTCTAGGGTGATTCATTGGGAAGCGAGGCCTTC
GAGTGGACCCCGCTAAGATAAGGGCCATAGTCGATTGGCCGGTTCCAAAGAACCAAAAAGGTCTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAA
GTATAGTGAGAATTACGCAGATATGGCTCGGCCATTATCCAATCTCCTTAAGAAGGATGTGGATTAATGTTGGGGTAATACCGAACATGATGCTTTTCAA
GCAGTTAAGGAAAGTCTCCTTCATAAGCCAATACTGGCTTTGCCCGATCCTGATCGGCCTTTCAGTGTCGTCTTTGACGCATCTGACTTTGCCATAGGCA
GTGCTTTGTTACAAACAGATGTCGATGGACGCGAACGCGTCATTTGTATTCAAATCTCGACAGCTCAAAGCTGCTGAAAAGAACTATCCAGTTGATGACA
AAGAGCTACTTGCTATGAAGTACGCTCTAGTCAAATTCAGAGTACATCTGCTTAAGTCCAAGCCATTTGTGATCTATACAGATCATGCATCATTGTGCAC
TGCGACACAGTCGCCGCATCGCTCTCAGAGAATGGCTCGTTGGCTTTCATTCTTTGCCGAATATAATTTTGAAGTGAAGTATAAGCCAGGAAAGCAAAAT
GCTTTGGCTGATACGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTGTTATCTTCAGTCACTGACTTAATCCGTGCGGCTTATGCCA
AGGATGAACAATGTGTAGCTTTGCTACGTGCTCTTGGGAGCAAGGAGTTTAAAACCTTGGACATAGAATTGTCGGCACGTTTACGTGCGAGGCTACATCA
ATATTCTATCGATAATGGCCTGTTGCGCTATCGCACAGATATTGAGGATAAATCTCGTATCGCTGTCCCTCATGATGAGGAATTGAAGTATCGAATACTC
TATGAGGCACATGATACTGTTTTAAGTAGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCAAGGCTTATCGGTGGTCCAAACTTTACAAGTGGG
TGATCACCTATGTGCATACGTGTGAAACGTGTCAACGGGTGAAACCCTCAGCACATGCGGCGGTGTCGCTGGCTAGTCTGCCTGTACCCACTGGGTGTTG
AGAGTCTGGACTTCGTGTTTGGCCTACCGAAAGATTCGGATGGCAACACTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGATGGCTCATCTAGCGGC
ACTGCCGGACTCTATTGATGCCGAAAGTACAGCGAAGCTGTTTATCGACCGTATGTTTCGACAACATGGTTTGCCAGTAGAAATTGTCTCTGATAGAGAT
TCCCGCTTCACTGGCAAGTTTTGGAAGTCCATCTTCAAGGTGCTCGGCACCCGTTTCGACATGTCCACAGCGGATTATCCGCCGACCAATGGTCAAACTG
AGCATGTTAATCGCGTCATTAATGACATTTTGCGCAGTGTTTGCGCTGATAAGCCTAAGCGTTGAAGCTCCATGCTCCCTGTTGTTGAGTTTGCGTTGAA
AAACGCTGTTCATGCCTCTACAGGCTATACTCCGTTCTACGCAAACGGTCTTACCCACCCTCGCGTTCCG