Description :
From Genome Similarity Track
Location :
Scaffold_355:22114- 24525
Transcript NameFunction/comments
Phyag_g4977hypothetical protein

Sequence
2411 bases(100 bases per row)
tgacgaggtggacgtggtgcgcAAAGATAGCGATGGCTGGTGGTTCGTCATTAAGGAGGGCGAGAAGGGGCTTGTGCCTGGATCGTATCTTCACATTGAG
AACCCGATCATCCCCATTACAGACGCGGCGATTCTGGCGGCACGTGAAGCCTCCAACCAGCGattccaggagctgcagaaaaGCTCTGGAGGCGTCGCGC
CTGGAGCTGAGGGAAGTGTTGAATACCAGTCGCCGTTGGGacttgaagcgcttgctATTGCAGACTCGTGCGCGCCTAAACCACCTAGTGGACCGGCGCG
AGCTGATGCCAAGTCCGGAGGTACCGAGTTTAAACCCGGCGAGGTGCGCAAGTTGAGAAAGTGTTACGCCTGCAAGGAGACAATTCTGGGACGCACCAAG
GTATGCAAGGACCAGATTTTCCACGAAATTTGTCTGTTGTGTAAGGGCTGTCGTGAGAGTATTGAGGAGGATGAGGACTTTACGctcatcaagaagaagg
cgtacCATGCCGACTGCGCCAAAGACGTCAACCACTGCATCGTGTGCGACAAAGAGATCTTGGGAAGAGTGTACcgtgctggcgatggcgcgTTCCACAA
GCTCTGTATGGTGTGCTCTGTATGCAATAAACAAGCGAAAGAAGCTGGATccaagctggagaacgacCTTCTTGTTTGCGGCGAATGCGTtgcggagaag
gagagaaaagagagagaggagagaGAAGCCGCGCTCGAACGTGAGAGGGCTGCGGCTAAGGCGAAGGCGGAAAAAGAGGCTGCTCTTGCGGCAGCTCGCg
cgttggaggaggagaaggagcgacaAGCCAAGGCGGCTGCCGAGGAGGCGGCCCGCGCAAAAGCGAaggcagaagcagaagcggcggctgctgctcgcgc
acAGGCAGAAAGAGAGGCTGCAGAGgccgaagcgctgcagagagctgctgccgcagctgTGGTAAATGGCCATGGACGACCTGGAACTGATAGTCTTCGA
TCCAGCACGTCAAATCTTGACGAGTTTGATTTGGAGGCGACCCCTATCGATATGTCGGGCCAGAACGGACGAATCTCCGAAGTATCAGATCTGGACTCGG
TGCTCAGCGACGGAGATTATGCTGGATACATGGGCAACGGCTCGAGGGAATCGCTGCGCTTGTCGGAGGTGCTTGACCTCGAGTCTTATGATGACCGCTT
ATCCGATCTAAGCGGTATCtcagaaggagctggtgaacGCAGGCAGCGGCGTTCAACCATCGAAAGGACCGTGAACGAAAATGAAGAAACCTTTTcagac
gaagatgatcgcGAGCTGTGCGGTGGTTGCGGTCTTGTTCTGGAGggagaagctgtcggcgctcTGAACCAGTACTTTCACTACGAGGTACGTGTGCAAT
GGTTTGACTTGTATGTGCTGCCTAACGAAGAGCTAAACTCTTGTGTCGTCTATGATTAACAGTGCTTCAaatgcagccactgcagccgTGCCATcgccga
agatgatggcTACGCAGAGAAGGACAACCAGGTAATTGTTGCGTTCTTAATTACCGTACGCGAGCTTATCTCACAATTTGCAATGACTTGCAGGCGTTCC
ACCAATCTTGCTACCAAGCTCGTTTCGGCAAGAAGTGCCACCGATGCGACAAGGTGCTCAAGGGGAAAGTGGTCAAGGCTCTCGATCATCTTTACCACCC
GGACTGTTTCGTGTGCTACCAATGCAGTGCTTCCCTTTCAGGTACGCAACAAATGCATCACACTAGCTGTCTGAATTGCGTTTTGTACTGCTTGATGCTA
ATACAGAAATTGATCTGGTGTTGTtttgtcgtccagcagagAGTTTCTTCGAACACGAAAGCCAGGCTGTTTGCGCGAAGTGCAAACACGAAGCAATTGC
ACTGGATGAACCCACCTTCCCGTACGTAATCCCTCTGTTTCATGCTATCCATGGCATTTCAACTAACACGGTCGTGCTTTTATTGAAATCAACAGAGAGA
ACATGACCCCGGTATCTAAGGGTATTGCTGGCTATCGGTTCGACGCCCAGGATGACACACAATTGACTATTTATCCGGGCGACGAAGTTGCAATTCTTCA
GAAGGTTCGTCGGCCGCGCTATTTGTTGTGCTACAGTGATTGCAGTAAAGTGTTCTAACATTGAGCTGTTTCTGCGCTGCAGGATGACGATGGCTGGTGG
CTGGTGGAATTGAGAAACAAACGTGGCTACGTACCAGGCTCATATTTGATTGAGCGCCCCATTGAGGAGCCGACACCtcagccgaagaagaaaaagggCG
CTTTCAAGAGTAAGCCCAAGCGCAAGCCGGGTctttgcagctcgtgctcaaCGCAGAATCCAGCGGAAGCTCGCTTTTGCCGAAGCTGCGGCAACAACCT
GATGGCCTAAA