Description :
From Genome Similarity Track
Location :
Scaffold_1507:2211- 5264
Transcript NameFunction/comments
Phypl_g13576hypothetical protein

Sequence
3053 bases(100 bases per row)
GCGGTGGAAAAAGGCTTCCCAAAGCAATAGGTATCGACTCTCCAAATTATTGCGGTTCGGTTTGACATTTGGAGACTGCGGCTGGGTGATGGTCCTCCGG
CTCGGTGCCGCCGATTACGATCCGCCTCAAGCCTGGTGAGGCGCCGTACCGATGAAAGGCTCGAAAGTATCCTCCTGAGGTCCGGAAATTcttggacgag
ttcaacgaTGAATTAGTTCGGCTCGGTTGGGTGTACGTAAGCACGGAGAGTCGATGGGCTTGTCCCGCTTTCCCTGTGCGCAAAACCGGTGGTGAGTTTC
GTCAGACGGCAGACTACAAGCCACTCAACGCACACATTGAAGCGATTGTTGGGGTGATGCCCGACCTACAGGTCGACCTCGAAAACGTGAAAGGAGGCGG
TCTGTTTGATTTTATCACAGGCTACTGGCAGCTTGCTCTCGCAGAAGAATGTCCAGAGCGGTTGTCGTGCTTGACACGTCGCAAGGTATACACTCCGTGT
CGGGTTCCCCAAGGATGCACCGACGCTGCGCTTTTTTTCAAGTCGACAATCCAAAAGTGTTTGGAGGAATTATTGCACAAGCATTTGTTTGTATGGATTG
ACGATCTGCTACTATTCGCTAAGGATGTCACTACTTATCTCGAAAAGCTCGAACGGTTGTTCGAGTTGTTAGATTTTGTTTGGGGTCAAGATCAGCCCGA
AGAAGTACGATGGTGTGGCAAACTGATTAACGGAGACGGAGTCCACCACGACCCAGAGAGGATCCAAGCGTTGCATACCATGCCATCCTCTAGGACAGCA
GGCGAACTGCAACAATTCTTGTGTGGGGCTAACTGGATGCTAGACTCCTCGATTGATTTCACCCGAGTGGCACGCCAAATCCAAGATGCGTTGGATACTG
CTCTCTCAAGTGCCTTCAGGCGCACCAAGCGTGTTGCTTCAGGAATGGCGATTGAATTAAGTGCAGTAGAGCGAGTTGCTTACGATCGAATGAAGAAACT
GCTATCAAGTAGTATGACTCTTGCTTTCCAAAGCAAGGAGCGGTTATGTGCTTCGTAACAGATACGTCAGATACCGGATGGAGCGTTCTGGTCTCTCAGG
TAGTTGAATGGCAACCACACAAAGAGGTACATGAGCAACAATACGAGCTTCTCATCTGTTTAAGTGGCAGCTTCACCGGTTCACAATACAATTGGAGTAT
TATCGAGAAAGAAATGTATCCAATAGTATGTGCTTGTGACAAGCTCAGCTATTTGCTACTCCGTCCAGGGGGGGTTAAGCTTTTCTGCGATCACCGCAAC
CTCTTCTACGTGTTCGCCCCGGGTAAGGAGGtaaagaaaaaaaacacgGGGCAAACTGTCGAGGTGGACAACCAAACTGATGGAGTATAGCTATGTAGTG
GATCATATTGAGGGCGCGTCAAATGTATGAGCTGACATGTGTCTCGATGGACCGGGCACCACGACCCGACCGTGCAGTTGAATGTTACGAAGCTAAGAAA
AGGGGGTCGAGAAGAGACGGAAGATACCCGTCAGCGGCGGAAGAGATGTTGTCGAGGCAACAAGAAGCATGCCTGGCTCGACGCGCCGGCACAGCAGACG
ACACAGTCTCAGTTGAGACCTCTTGACGAGGCCGAATTTGAGTGGCCGAACTTCGCTGCTATTCGagcagtccagcagcaacatgcaGATAGCCGACCTC
GCTCTGCGATTGGTGATGATGAAAATACATGGTACATCAGAGAAAGAGTTTGGATTCCGAAAGAAGCAGACGAACTCATCCAGCGAATATTAGTCGTCGC
ACTGTGGCCCCCAAGGCCACCGTGGCCGGGATGCCATGTCGAGATGCTTCAGAAGGCTCTTTGACGTACAGTATTTGAACACACGAGTGGATGCTTTTCT
GGGATCGTGTCGACTGTGTAACCATGTGAAAGGTGGAAAGATAATTCAGCGATCATGGGGCGAAACGTTTCGAACGAATGAGCGCAATGGCACGTTGCAT
TTTGATTTTCTTTCTCTCGGTGAGAGTTTTGAAGCCGATCGCTACCTGCTAGTACTCAAGGACGAAACATCTCATTTCACAGAGCTCACCCCTTGTGCga
tctccacgagcacggTCGTTGTAGAGGCACTACTAGCTTGGCACAGAAGGTACGGTGTTCCTTCGGTCTGGATCAGCGACCAGGGCTCACATTTCAAGAA
AGTGATTTCAGCTGAGCTATTTAGAAGGATCAAAGCACGACATGATTTTACGGTTATGTACATTCCATTGATAAATGGTACAGTAGCGTGGAACGAGCAA
ACCGTGATATAgtgcagctccttcgtgTTATGTGCCTCGAGTATATGGTGGACATACACGACTGGACATTTTTCGTGCAAATGCTTCAATCCAGAACCAC
ACACCCGTTCCGCCATTAGGGAACCAAGCTCCAGTTGAACTTTTTGCGGACTACCTCTGCCATCACGGTTGGCATTCTGCCTtgacaagaaggagaagca
gtTACTCGAAATGCCCGAGCAACCACCAGGTATAGCAACTTGGCTAGAGGATTTAAGCAGCAGAATTCGTGATCTCATTAAGCCAACGGTACAAGCACGC
TTACGACAGACTGTGTGCAATCAGTGAATGCAGAAGTACGCTAGCCGCCCCAATTTTGATCTCGGTGATTTCGTGCTCCGATCGAGGGTTGATCAGAAAA
ATTACGCCAAACTTCTAGTAACATGGGTTAGGCTCTACTAAGTGGTGCGAACGGACACACATTCATTCGCGGTTGGTCATTTGCTGACAGGGGGAGATGG
ATATCCACCTGTCACGCTTGAAGTTCTACGCGGACAGCTCTCCGCAGATCACTGAGGATCTCAGCGATCATATAGGCGCACATGACGTGGTCTTGTCCGT
GAAAGAGCTGAAAGAGTTTCGCTGgaacaaggacaagaaaGACTACGATGTACTCGCTGATTGGAAAGGCTTCGAGTCGATCGAACACTCGTGGGAACCA
ACGCGACAACAGAGCAAGGAGATACCGGTCTTGCTGAAGCCATTTACGGCAAC