Description :
From Genome Similarity Track
Location :
scaffold_540:2211- 3483
Transcript NameFunction/comments
Pl_103970endo-1,3(4)-beta-glucanase, putative

Sequence
1272 bases(100 bases per row)
GGCGGTGGCGAGGTCACTCTCAGCCCCTACACAGTCCGCAGTTTGCCCAAGAGACTGGATATCTCATACGGAGACTCTCGTCGGGTGGCCACATCCACCG
CCGTCACAGAGTACTTTAACGTGGACGCCAGCTTCACAGCCTACAGTCGCAAGGTGCTGAACGACAATGAGACGGTCAGCGCCTTGCTGGGAGACGGCAA
CAGTACATCGAGACATGTTGTCGGCTTTGACGTGCTGTCAGTGTTGCTGCAATATTACTATGGAGAAGACAACAAGTGGATGAAAGTGCCTATGGTGCGA
GGTTCACCCTACGTTACGGTGGAGTACCAAAATGTACTCCCTGTGCTGGAGTTTAATGCCTCGGTACTGAGCATTAATGGCGAACAGGTAGAAGAGAAGG
ATCCGTTGACCCGTTGGAACAAACTGCAGACGTGGACTAACAACCGCTTCGAACTCGACATTGAGGTCTACGGTGCTGGAGAAAGCGCACAAGGCACTGG
AAAGGCCCGACAAAAGTGGATTCTGTACTTTGACAAAGTGCGCACGTTGCAGCTACAGTTCGCTAATGAGAAGGACTACAGACCGTACAACTGGCGTGGT
GAGCTCACTACCCCTACCAACATTCGTCTGGTGGATACAGACTTTTACACGGGAGCGGCAAGGCTCGCGATTGTTCCACAAGGAGCAGCGCAGACTGTTG
TTGATACTTTAGACAAAGCTGCAGCCATTTACCCGGTGGGCTCTTCGATTACGACAGATGTGGGTGATGTCAAGGCCTCGTTCTCGTTCTGTTGGAAAAC
GAAGCGGTTCCCCGATCTCGGTGAGCCGAATTTGAGCTCCACTTCGACCGCTGAACTTCTCATGCTGGCAAACCCGCACCATGCGGCGACTCTTAAGGCG
GATAGTGATGTCTTCCAGGTACTTGGCCAATTTGGACACCGCACCCTCAAGTCAAACATGACTGCGGTGCTCGGTGGCTGCTGGGAGCTGCAAGAGACAC
TGCCAACGGCCTCGTTCCAAGAAGAAAACGTGCAGATCCAGCCTCAGTATTTGGATGCGATCAAGGTTGCTCTGGCCAACGACTCCAACTACACACCGGA
AGCCGATGACCCGTACTACTTCGGTAAGGAGATTGGTCGCCAGGCCCGCCTGGTTCTCATTGCTGACAAACTCGACGAGAGCGAGCTTCGTGATGATATG
CTTGACAAGCTTGAGGAGTGGTTGACCCCGTGGATGTTGGGCCAAAACAGTGACCACTTCGTGTACGACCGC