Description :
From Genome Similarity Track
Location :
Scaffold_2340:2211- 3382
Sequence
1171 bases(100 bases per row)
TGTAGCAGCTTCAATGCAAGACTTAGTGAACGAAGTTTCGAATGGATAGCCAAGATGTTTCCCGAAGAAAACATTGCGTCATTTGGCAATTTTTGTCGAG
CCAAAACTCTGTATAGAGTCATGCCACCCAATCTGGCTGACGGCGCGTTTATATCGGCCTTTTGCTATTGGCTTCATCAATCCTACCCCAGTGTTTTCCT
GGTAGGGATCGCAACCGTCCACCCTCATACAAGACGCTCGAAGAGGAATTCAATGGATGTTCACATCAAacggaaggcgaagaagttAATCAACAGCAGA
ACGACGCTGTTGATCCCGGTTAACTTTGGAAATATTCACTGGTGTGGAATTATCGCGGACGCTACGACAACAAAGATTTGGTTGTATGACTCGATGAATT
GCGTTGGATACAAACACGCACTCAAGGAACTTTCGCAAGATTTAGTGAAGGAGTTAGATGCCGAATTCCACATCGACGAGTGTTGTACTCCCGTACAATT
CGACAGCTTTAGCTGTGGATTTTTCGTCTGCCTGAAGTTCATGTGGTTTGTGCGCCCATCAACCTCTCTAACAACCACCGGCAATGGGCTACTAGTCCAT
CGATTCTGTCTGCTGTACTACATGCTCTATGGGCGTCATTGCGACGACGCCCAAGGTGGGGAGTACGCACTATCACTTTAGTAACTTCAATGCTTTACAT
TTAATGAACAGAGTTCCGATATTCAACACTTGATCATGCCAATGATATCCGCATGCGCACTGGATCATATTTGTGCTCGTCTTGCTGTAGTTGTCGATAC
CGGTTACATGTGACCACTAAAATCTCTGGTAAACGCCTCTGGCAAACGCCAAGCATTGCAACGAGCACCGCGGGCAAACGCCACGCAGTTGGGAATGTAT
TCCATCCGACAGGTGAACGGTAAAATATTAACAACATAAATTACATACCTGGACGATAACTGGATCGATACCTGGACAAAACCTGGAGTCGATACCTGGA
CGGTAGCACTGTCCAATTAAAACGCACTCGACCAAGCCCCACCGATTTTCTAtactcacttcgcaattttGCTAACGAGCCATCAGTGATCAAGCTCTAG
CTACGATGCGTCTGTACTCGGTCGCACTTgtagttgctgttgttcttcTGGCAAACGTCGAACGGACCACC