Description :
From Genome Similarity Track
Location :
Scaffold_184:22109- 23450
Transcript NameFunction/comments
Hyaar_Emoy2812092GTPdependent nucleic acidbinding protein engD putat

Sequence
1341 bases(100 bases per row)
AGTAGTGCTGATCTTTCAGTGTTCACACGGGGATGATATTCGATCTAATCTCGTCCCTAAACACTGTCACTAATCACTTCAAATGTCTAGCCTTCGCCAT
GCGTATAGCTCCAGCAGCGATACTTTCTGAAGGTCGACATAAACGTCAATGCCCAGATAGAGAGCGTCATCACGTTATACTTTTGCAACTTCCTACTTAG
CTGAGACCTAGCCATTAGCAATCAACACTAGTACCACACCACTTACTGGTGTTCCATCTCTGTCCCGTCACACGCTGCACATAAAGTACAGTACCATATC
TGTCAGCGCTCCGCACTACCAATCAACCATGCTGTCATGTGGTCGTGTCGTCAATCGCACACCTTATGGTTGTCGCAGTTTCCAGCGCTCGGTGGGTATC
GTGGGGATGCCCAATGTCGGCAAATCCACGCTATTCAATGCCTTGACCAAGACCGAAGTGGCTCAAGCTGCGAATTATCCATTCTGTACCATTGATCCCA
ATGTGGCGCGCGTGGCTGTGCCTGATGACCGTGTTCGTCACTTGGCAGAGGTCGAAAAGTCCAAGCGAGTGATTGAGACGCAGGTAGAAGAAAAGGAGGG
ACGTTGCTGTGTTTTGCAAACCAAGTGAATGATGTGCATGGGTTGTCAAATCTGTGTGTGGGTGTCAATCAATAGCTCGAGTTCGTGGACATTGCTGGAC
TTGTGCGTGGAGCTTCGAAAGGCGAAGGACTTGGTGAGTTTTGCATGCGATGCACCTCCAGTATTTAGATAATCACAGACACGAGGTTGACGAGAGCTGT
TGATGGTCAATAGGCAACAAGTTTCTGGACAACATTCGGCAGGTGGCGGTGATCGCTCACGTCGTGCGCTGCTTCGAGGACACGAATATCCTCCACGTCG
ATGAGTCAGTCGATCCGATCCGGGACCTGGACACCATTCGCACGGAGCTGATCCTCGCAGACTTACAGACAGTTGAGAAGCGCTTGATGAACGCTGTCAA
GAAGAAAAAGTTGGTGATGTTTTATGAGGTGCTGATGGAAAAGTGCACGTCCAGGTGACTCATGGTTGACGTGCTGTGTCTTGTTTCGTGGCAGATCGAC
AGATCCGACGATTTTGTCACTGTTAGAAGTTCTACAGCGTCTGCAGCCTCACTTGGAAGATAGCCACCTCGCGAACAGCCTGACGTTCGAAAAGCTGGAC
GAACAAGTGCAGTTCGAGCGTCTTGAGCTGCTGACGGCCAAGAAGACCCTCTACCTGTGCAATGTGTCAGAAGAAGACGCTGCTGCAGGCAACGAAATGA
CGAAAGCTGTGCGGGATCGAGTTGAAGCAGAGGGAAGCCTG