Description :
From Genome Similarity Track
Location :
Scaffold_78:221086- 224662
Transcript NameFunction/comments
Phyci_10966Hypothetical protein
Phyci_587874metalloprotease family M14B, putative
Phyci_94932Hypothetical protein

Sequence
3576 bases(100 bases per row)
CCGTCTCCGAGTGTGTGGTCCTCGATGTGGACCTGCTCGTTGAGCTCCGACATGGCCTCCTGCCATAGCTGGTCGTACGTGCTGCGCCAACACCCACGTA
AGCTCCACGAACAACTTGAAGCGGTGACAGACAATCAACCAACCAACCTGCTCGCCATCCTGGAGTGCTTGGCACCTACTTGGTGATCCCCCGCGGCTAA
ACGAAGACTGGTCGCTGCCGTCGTTTCGAGAGCAAAACCCCCTTGACACCACCGAGCTCTCCATTGCTCCATTGCTCCACTGTTCCATTGCTGCGTGAGT
GTCTCCATACCTCCCTCCTTGTTCGTCCTTTTTGTCGGCATGCACGGGTGAGCTCGTCAGCTTTTGCCACCAAGTACTCGGAAGCCCGAGATCGTTGTCA
CCCCGATTCAGTCGTCCAGAAGAGATTCATACCCCGCCAGGCCTTCGTCTCTTCGAGCTCAACTACTTCAGCTCAACGCAGCAGCGATGAGCAATTCCAA
CCCTCGCGCCAACCGGTTCCGCAAGGTTGCCAGCCAGTCACTGTTGCTGCCGCCCCCACTGCCTCTCATCAACCTCCCGGAGGAATCGCGACTGGCCCGC
ACGGGGATCCAAAACCAGCGCCCAATGCACCTGCCAGTGCGCAGGCACATCCCCAACGCGGTGGCTGTAGCTGCGTTGAAAGCCAACGCGGACGGGGGGC
CAAAGTGCCCCGAAGACTTCGACAACCCGCAGCCGCCGAAGCGAGAACCCATTCTCATCGAAAGCCGGGCGCTGCTCGAGTGCGAGGCTGAGGAATACGA
GGAGCTCGAGGTGCTTGCCCGCCTTCACGTGTACGAGTACAACCAGCCCGACATTTTCCGGAACAGCAGCGCTCCTGACGACACCCTCATCTTCGACTCG
CTATTCGAAGGCGGTAACCTGCAGCGCGCGGAGCGAATATTTCGCAAGACGCCGAAGACCGGGTCAGCAACTCACACTCCGCAGCAGGAGTACGAAATGC
TCATCCATCCAGACATTAAGAACGGCGCCTATCGTCAGTGGTTTTACTTCGAGGTGCGCAACGGGAGACCCGGGATCATCTACCGCTTTGCACTCGTGAA
TCTCGCGAAAAGCGGCGCGCTCTTTGGCCAAGGCTTGCAGCCCGTGATTTACTCGGAGCATGATGCTGCAACCAAAGGAGTCGGCTGGAGGCATCGAGGA
TCCCACGTGCGGTATGACGTTGCTCCGACAGCTCAGCCGGGGCCCAACGCACTGACTTTTCACTACCAGTTCGAGCATGAGAACGACTGTGTGTACTTCG
CCTGCATTCAGCCGTACACGTACACCGGTACGGTTTCCGAGTTTGCTTGTGTTGTTGCCACGAAATTCATGTCCGCTTTGCCTTGTTTGTTTGCTCTTTT
GTGCTGTGATCTGTAGATCTGATGGACTACCTGGAGCAGCTCGAGCGCGATCCACAGCGTTCACTAACGTGTCGTCGAACAGAACTTTGCCAGAGTCTCG
CTGGAAACCCGTGTGATCTGCTCTCCATCACGTCTCCGGGAAAAGACGGGATCCCGCCCGATGAACGGCGAAGTACGTGTTGCCCGCAAGACCCCTTTGC
CGCATTCTAACTCGTTTTGCTGGCCAGTCATCGTGTTATCCGCGCGGGTGCATCCAGGTGAGCCGAACAGCAGCTGGATGATGCAGGGGATGCTGGACTA
CCTCACAGGATCCAGCAGCGGTGCCACGATACTCCGGCGGCATTTCATCTTCAAAGTCATGCCGATGCTGAACCCCGACGGTGTCATCAATGGCAACACA
CGCGTTAGTCTTGCCGGTTGGGATCTCAACCGCAAGTGGAGCAACCCCATCGAGCAGCTCTTCCCCACAGTATACCATCTCAAGCAGCAGCTAGCACACT
TCCAAGCTTACGGACGTGTGGCCATTTACTGCGATCTTCATGGACACAGCATTAACCGTAACATCTTCATGTACGGCTGCTACACCACGAAGAAGAAGCC
CAGCGGCTCAGATAGCGCTAAGTCTTCAGCCGCTGATGCAGCCGCTACGACGGGCATGACCACAAGTCCAGTTAGCAACACTGTGAAAACCGATCCGCGT
GTTTTCCCCATGATTGTAGCTCGCCACGTACCGTGCTTTTCCTTTGCTAGTTGCGACTTCAGCGTACACAAATCCAAGTTGACTACGGCACGGGTAGTAG
TGAACCAGGAACTCGGCGTGACGAACAGCTACACCCTCGAAGCAAGCTTCTGCGGACCAGACTTCGGGGTGCACAAGGACACACAGTTCTCCACTTGGGA
TCTCGAGGAAATGGGTCGATCCTGGTGCCAGAGTCTGCTTGTATACTACGGACTCACCGCCCAGGTCAAAGCACTGGATGCAGAACGTGAGAGACAAGCT
GCAATTGGTGAGCGAATCGTTGTGCCATCTCCAACTGGTCGTCAAATGTCACGAGCACGTGCTGGGGATGGATTGCTGCGGATGGAGACCGAAGATGAAG
AGAGCCGCCTAGCGAGGGACCTGTTACTTGACTGCGAGGCAGCAATCTCGGCGTTATTCGCGCATTCCGGCATGGACGTCAACGACCGCGTAGGATCTGA
AGACGATGCCGGTGGCATGGATTCCGATTTGTCCGGCGCTGAAGACGAGCCGATCCCTCCTAGTCCAGACAGGAGGGCACAGCAGCACAGTCCAGAAGTT
CAGAGTGAGCGCAAAAAGCAACAGGATGACGATGCTGTAAATGATGCCGAAGGGTATTCCAGCGCCCCGGAGGATTTCCCTTCACGCAAGAACCGCACGA
AGCCCACTCACACTCGCAAAAAGCCTGGGAGACGTAAGCACACAAGGAACAGCGTATCAAAGCAGAAGTCAGCGGCTATCCCAACATCTAGAAAAGGTGA
CGGCAAAACCAAGAAGAAGAAAAAACGCAAGAGTAAATTGGAATCACGACGCACCTCCTTGGTGGCAGCAGCACCAGCGCCGCCACTGGGCCCGAAGGTT
GAAGATGCAGCTCCTATCATTGCAGAACAACCACCGGACATTGTTGTAAGAAGTTCGTTAGCTTATGACGTCTTGAAGACGTTCCCGAAAAAAGTGACCA
CCTCGCGATGCTCGAAGAGCAAAAGTGGTCGCCCGAAGAGCTCCTACGAGACCCCGCGAAGTATCTCCAGCGCGATCCTGAAAGCAACTATGAACGCGGA
GCTCGCGGCTTCGCGGGCCAGTTTGCGCCTACGTCCGATGACTGAGTGCCCGAACACAAGCAACACGCTTCTGGTCCTGCCGAGTGTCTTGGATGGAAGT
AATCGTAGTGGCAGCGTGCGAATGCTGAAGACGGCTCCATCCTATGACCAAGAGTATCCCACACTAGAGGAGAAAACCCGCTTCAGCTTGGCCAGGGTGC
GCTCGGAGCTCCCAGCGTTGCAGAACTCTGGTAGGGACGAAGAGCAGCAGCGGCACCTGCGGCATTGGGGGCAGGAAAACGACGACATCCGATCCGACGA
AGATTCCGACGCCAGTTCCGAGCGGTCCGAACCGGAGGCGTATACTTCCAGCTCCCTAGCTTAGAAGCACTGAACT