Description :
From Genome Similarity Track
Location :
Scaffold_263:22104- 26593
Transcript NameFunction/comments
Phyta_totarag6380hypothetical protein PHYSODRAFT_349593
Phyta_totarag6381hypothetical protein PHYSODRAFT_478586

Sequence
4489 bases(100 bases per row)
ggCGTGGTGCCAACCGCTCGTCGGGGTTGTCGATGGATATGTCCCAGATGAATCTGGGATTCCTCTCGGTTCCGGAGGAGCCGAGCATGGCTGATCTCAA
CCCGCATCGGTCGCCACCGCAACGCAGCGCGAGTACCTCTGCTTCCTCATCAGGGAGCAAGAAGATGAGCTCCGATGATGCGAACCGGAAGCTGTACAAG
TGTGGTCGCTGCGGACAGCCCAAGGTGGGCCACATCTGCACGATGCCCGACCAGCGCAACAACTGGACTCAGGTGGACCTGGAGGTCACCAAGGGGCTCA
AGGTCATGCGCATCAACTGCCACATCATGCCGGTGAAGAGCAAGTGGGAGACGCAGTGCGACGACCACGAGCCGCCGCAGCTCGCGACGAAGGGCGACGt
caagagcgaggaggaagtcGAAGCAGAGCCGCTGGGACTCTGAGCGCACCTGGCCGCGCTCGCGTCAAATGTATGTTCTACCACGGAAACCTCCATAAAG
CACAGAACTGCACATTAATAACGATAATATGGACAAATGTGGGTTTACTTCATCGGTTGCAACCTTTCAGTTGCAAGCTTCcagtagtacatgtattaac
gGTCAcgggtacatgtaatgcCGTAAGGATCGGATTGTCAATTCATGTGCTCCTGCTATCCGTCGTCATTAGATTGTCTGTGGTGGCGATCGGCAAGGCG
TCCACGCAGCAAAATTCGCGTCGCCCTTGAGCAGATTAAACAGCGCTGCCACGCTTTAAGCCCGCCCAGCTGGGACCGCGGAAGCTCGCTCTCCTTCGGC
GGTGGACCAAGCTGCCTATCTTTGATGCAGACCGCAATCACGTTGGTAGCGTCACGACGATCCACGCGCTCTCTATGCGCGACAACATCATTCCAGCGCG
GCAAATTCCTGCCGACCGCCGTCCAGACCCAACTTGATCACAGATTATGCCAATAAAGACCGCAGACGGTCGAGCACCGATACTAAGAGATAGGCACCAC
ATGACTGCAATTGCACCCACACGTGGGTACACTACTTTCAAGACGTTCAGTCCTGCAGTCTGCAACTGACGCCTGCCCTCCTTACTTCGATCCTAAACGT
GATTTTTCGCGTTAACAAGCTGTTTGGTGACAGCATACAAAACTGTTTCTACAAAATCAAGTTTTCATAACATATACTATACATCATGATAGTATTTATC
GATGATCGCAGGTTTTACCTCGGTATGACAAAGACAAAGCAAGTCGTCTGGCTCATGGTCGCCATCTGTTGAACTGGCAACAGGTCTCGCCTCTTGCTGA
GGCCCTGCCCTGCCCTGCAAGACACAGTAACCAGCGTCCACCATGCAGCAaaggcgacggagacgcgCGAGTCTCCTCacgatggcgacgctgctctctt
cttcctcttcttcttacGCCCACGAATGGACCACGAGTCGCAACTGCCtcgcgagctgcacgctCAACGCTCCGCTGTGCCTCGTGTCGCCCCAAAACGG
CGAATGCATGGCGCTGACCCAGGCCGAGACCGCGGGTGAGTGGCGCATCGCTCTGGAAGCCACGCATAGCTACAACATCGGGGTTGTGGAGCTTTCGCCC
CAAGttcagacgctgcagctgcagggAGACAAGACGCGCGTGCAGTTCGACGCCGCCAGCCTCTGGACGGGCAGACGACTGGCGGCGCTGCTATTTATTG
GCCTGGACCTGACCAACGCCACGCTGCCCAAGCTGCCGAGCTCGCTCACGGAGCTGCATATCGTGGATTCTGTACTCAACAATCTGCCCGTGgcgtggct
gctgtcgctgcccCAGCTCAAGACACTCGTGCTGACGAACATCAAAGTGACGGATGAGACTCAGACGCTGATGGAGCTTAGTGAGCAGCAGTTTAAGTTG
CTGAGCAGTCGAGTGACGGGTGATTCAGCTATTAAACAGGGGGAGACAGAGGTGGAGGAAGCGAAGGCGACAGCGTGCACGGATGTACGAGGAGGTAGCG
TGCAGAGGTTGGGTGGATGGCCAGTGTGCGTCACCACCGACGACGCAGTCATTGCTCGACGGCTGCAATTTTCGGTAGAGTCTGGGTCCGACGAAAGGTA
TTcagaaagcagcagcgatggctCCAAATCTGCCGATGATCAAGACCATTCGACACTCGTGATGCTCAGTTTGGGCTTGCCATTCATCTATTCCTTATAC
AAGGTGGGGCTCTACATCTTCTTTATGCGGACATACAATCGGAATCCCAGCGAGCGTGGCGAGGCATCGCGAGTCAACAACACGAAGAACGTGGCCATTG
ACACGATACATGATAGCGACGCGGATCGCCCCACCGCCAACGACTCGAGtacttctccaccagcgtctccgtcacctcgCGTACATCGAAGGCAGGATAA
GAAGCCatccaacagcaacaacgctgGTTTCtgggtggaggaggagctgcagccgtGGCGGTTGGACTTTCAGCGCCTGAAAATGCTGAAGTGCCTCAAC
TTGCTGCCAACTGAAAAACGCCAAACGCTTCGTAAGCAAAGTGTCACGAGCGAAATGAATCCTCGCGAAATCTGGCTAGCATCGCTTGCAGCAGGAAATG
CGTCTACGGCGGCAGTATCACCTGGAGGAGGCACCACTGATACGTTGGTAGTGGCTAAATTTCTGGCACCCAAGGAAAACCAGGGACCACGTTCGTCTGC
AAGTGGAAATGGCGGTGGGAGTGCGAGGGATAAACTGAAGAGCGAGTTGAAGCGTCAAGCCATGTTCTCACATCCACAGGTGGTGACTTTCATCGGGGTA
GCATGGTCCCGAGAAACGCATCTGCTCGCTGTCACCGAGTACATGGCTCAAGGCGATCTCCGACAGTGGCTTCATCGTACTGCGAGCAAGCAATCTGGTA
AATGGTCAGTCCTCAAAgtgcaaatgctgctggacgtgagCAGGGCACTGCTCTACCTACACTCAATGCACCCGCGCCTGGTGCACGGCAACTGCAACTC
GCGGAACGTGCTGTTGGACCAGTCGCTGCGTGCCAAGTTGAGTGACTTTGGCGTGGATGGCCGATCCGATGGTCTTagtgagcaggagctcatgTCGTAC
AGTGCTGTAGGATCGGGCCGTTGGATCTCCCCCGAAGCGCTCCTGGGCCGCGAGACAAGCGCGTCGTACCCggacgccagcgacgtgtACTCGTTTGGAA
TCCTGATCGCCGAGATGGATTCGCACGAGCTACCCTTCTCGGATTTGATGCAGGCGAACCGAGCAGCTGTGCCCGAGACAGACATCCTGCAACTGATTGC
GAGGGGTGCGCTGTCGCCCACGCTGTCACCGACGTGTCCAAAGAGCGTCGTGAAGCTCGTGAACGCGTGCACCAGCTACAAACCCAAGTACAGACCCAGT
AGCACACAGGTGCAGCAGGACCTACTGCGCATTTTGGAAGACTTCCGGGAGTTCGAGAGCAAGACGACGGCTACGATCTCGGTTGGAGCGCCGCGCTCGA
ACCCGCCGTCGAATCTGGTATGAGGCTGCTTTAGCCTATTAGCCCTGATAGTATAGGGATTTTTGATGTCCAtaaagaagaagagaaatTTTGTCAGAAC
AGCTATCATGTAATAACTATGTCAGGGCATTTGGGGTGTCAGTGACACCGTGTcacatgaagaagatctgTGAGCGAGATCCACGCGAACACTTGGCGGT
TATTGCAGCTCTGTCATCGTTCGATGCCTTCGCACAATGTAGCCACCGATCCTGGATGCGGCGCTTGTCTTGTCTGTGTGGACGCTGGCAAAGGTCGTGG
GCCTCGAGTCGTGGCCATCACGTCTGCAGAGACTTGTGCGTGCACTAATTCGAGGCGGGCGACAGTTTTCGGGACACTTGCGGCAGACTCCGTTTCATTT
CGCCGCCTGTGGTTGGCTTGATGGCCGCAATCTCGCAGATTGCTTGCGCACGGAAGCGCAGCGTAATCGCGGCAGACAGGACGACGGGGCGCCAAAAAGT
ATCTTTGCGGGAAAAACTGACAGGCGACTCGCCTGGAGTCGAGGTGGCGCTCGAGCCTCGAGGCCGCCTACGCTGCTATGTCATTGCGAGTGCCATCAAT
CAGGATGCAATGGATTTCAGCATTCGGTTGCGCTGCAACGTGACCGCCCCGAGCAACCACCGTTACGACTCGTAAGCGTATGGATAGGCCGACTAAGAAG
TAGGGCAGGACTTAGGTGGTCGTCAGGAAAAGACTCGTCCCGGGTATTTTCCCGCGGCGAACCCACATCATGAGCGCGTACAGTAGGGCTCCCCCTTCTA
CCATCGCGGCTTGATGAGAGCCCTACTTCGGAGAGAAGTGTCCCTGTCCTCCGGCTTGCGGCGCGTGATCTTTGTGTTTGGATGGCAGTCAGTCAATTCA
AGCGCCAATTGCTCGTCCACGTGCCAGTGAAATGAGTTTGGCGCACTCGCGCCGGCAAACAGCTTCGTCAGCGGAGACAATGGCCCCCA