Description :
From Genome Similarity Track
Location :
Scaffold_2135:221- 3232
Sequence
3011 bases(100 bases per row)
CTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGAATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCAC
TTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTAC
AGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGATATCTCGGGATCTGTACATACCACGGTCCCG
GGAACGGTATCCCCCGACCGCGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGATGCTGTGAGACAGACTCGACGGTAATCCTCTGGGTCGGAGTCCG
AACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGACCTGGAGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGAC
GGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCAATCCACAGCCCGCAGCACTTCTTCGAGCTCATCTGCGTCTGGAAGACGTAACAGGGTCAGC
CTGTCGACCAGATCCACATCTCCCAACGTCTCGATGAAATGATCCACATGTTCCCGTAGTACGTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTA
GACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTACCACCGACACTCCCAATCCACA
GTACTGGGTCTGGAAGATGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCTCCGCTAGCAGATCC
GCAAAGGTCAAACTTTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCT
TGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGA
CGAAGTGGATGGGCCATCTCGATCATCTGGGTCGAACTCATCATGGAAGTTGTCTCCCTCCACTGACTCCATTTCCACGTCTCGTGCTCCATGTTCGTGG
AGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGT
CGGAAGAGCCTGTGGCCGTCTGGTTCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGCTTCTTGCCGGA
TCTGGCTCGATCGTGGCTGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCACGAGCCTTCGCGCTCACAGGGACTTCCTGTCCTCGGCTCCTCGCC
CACGCTTCCAACATGGATGCCCCGGAGGGTTCCTAAAGTCATGCGTCGTGTTCGGACGACGTGTCTGACTCATTCTCAGCGGCGGATTCGTAGCAGCTTG
GTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGATCC
CAGGTCTAGCCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATACCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAGCTTGTTCG
CCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCGTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAGAGC
TTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTTTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTA
GTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACGGAGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTT
TCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGAAGACCTGGGGAGGATAGAGAGGTTTCTCTTC
TAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGAT
CCGACCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTTACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGG
GATCAGCAAAATCTGCGAGATTGCTGGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGCCCCCCCGATGATCCGTGTTCTGCTGAAC
TTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGG
GGATGGGGTGGAGCAGCAGTGGAAAATCTTCAATCTGCGTTCGTGGATGGTTCCGAATCCTAAGCGATTATTCGAGCTTATGGATCCGGGGCCTAGATCG
TGGATCTGGCCGTAGGGCTCCTTGCGGGTGTGTCCCTTGCCTTTGTAGTTCCTTTACGTCGTACTTGCCGCCTCATGTGACGGGATCTTGAAAGTTGAGA
GCCCCTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTA
TTATCCAGTTATCACTACCAACACTAGATTCGCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAAGGCGCTT
GCGTGTCACTG