Description :
From Genome Similarity Track
Location :
Scaffold_1515:221- 1669
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1515-fgenesh-gene-0.0Pyruvate dehydrogenase E1 component subunit alpha

Sequence
1448 bases(100 bases per row)
CACCCGTTTTGCGGCCACCACACGCTCGGGACCGAAGCAGAATTCGTTCTTCCTCGCAAGCCGCAAGCAAGAAAGAGAGCTCCTGGTCTCCCTTTGATCC
CCTAGAGACAGAGAGATGCTGCGCCAGTCCGCCGGCGCCTTTGCGCGCGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGCGCCGCCGCCAGCGGCGACGTCAAATTCGAGTTCGTGCAGCCGTTCAAGCTCCACAGTACGAAATGAATGCTCTTCTGAGGGAGGATGGTGATGG
ATGAGGTGTGTGTATGTCCTAGATTCTTACTTTTCTGCTGTTGCTGTTGTGTGTATGTAGACCTTGAGGAAGGCCCGCAGAACTTTGGCTACGCGAACCG
CGACGAGCTGCTGAGCTTCTACCGCCTCATGTACACGATGCGCCGCATGGAGATCACGTGCGACAACGAATACAAGGCGCGCACCATCCGTGGTTTTTGC
CACTTGTACGACGGCCAGGAGGCCGTCGCGACCGGCGTGGAAGCCGCGCTCGACCGCAAGGACTCGTGGATCACATCGTACCGCAACCACTGCACCATGC
TTGCGCGTGGCGGTACTGTGAAGCAGGTGCTCGGTGAGCTTTTCGGCACGGCATCCGGCGCGGTGAGCGGCAAGGGTGGCTCGATGCACTTCTACAACAA
GAAGGAGAACTTCTATGGCGGCCAGGGTATCGTCGGTGCCCAGGTACCAGTCGGCGTGGGTCTTGCTTTCGCGAGCAAGTACAACCACAAGGGCGAGGGC
TTGATGCCGTGCTCGATCTCCATGTACGGTGACGGTGCCGCGAACCAGGGCCAGATCTGGGAAGCCGCGAACATGGCCGCGCTCTGGAAGCTGCCAGCGA
TCTTCTGCATTGAGAACAACCACTACGGCATGGGCACGTCCGCGGAGCGCTCGTCGTCGAACACGGAGTACTACACCATGGGCAACAAGATCCCAGGTAT
CTGGTGCGACGGCAACGACGTGCTCGCAGTGCGTGAGTGCACGCGCTTCCTGAAGAAGTGGTGCGGCGAGGGCAACGGCCCGATCTACGTCGAGATGAGC
ACGTACCGCTACCACGGCCACTCGATGTCGGACCCTGGTGTGACGTACCGCAACCGCGACGAGATCTCGCAGATGCGCGCGTCGCGCGACCCGATCGAGA
GCGTGAAGAAACGCTTGCTAGAGCACAACCTTGCGACCGCCGACGAGATCAAGGAGATCGAGAAGGAGGTGCGCGCCGAGGTGGTCAAGGCCACGAAGGA
GGCCAAGGCGTCCGGTCGCCCAGAGGAGGCCATCGCGTTCCAGGATGTGTACACGGACGGCAAGGGCGGCAACGAGTTCCCACCGTTCATCCGTTTCCCA
GACTACACCAAGAGCCTGTACAACGGCAAGCGCAAATAAACGAGTAGC