Description :
From Genome Similarity Track
Location :
Scaffold_2450:221- 1307
Transcript NameFunction/comments
Phymu_g14125transposase

Sequence
1086 bases(100 bases per row)
CGAGTTCCAGCAACCCTCAATCGGGTTAAGCATTGGGCTGTACGGTCCAAGCCGTAGGATCTCAAGCCGATGCAAGTTCATGACTCCATCTTCGGCAAGC
ATTTGACGGGCTAGCGTCTCGACGCCACTGTGTGCTGGGGCGTTATCCGTCACAATGACGACCTTCTGGCTCGGCTCGAGTTCTCGAAACTCGTTAGTGC
GCAAGGCCGCCATGAATAAGTCGGCTAGAAAGCGggcgttttcttctttcttcacGGAACCCTCATGTGTTTGGAGCAGCACAATACCCGTGCCAGACGA
AATGCCACCCTGAACATGAAGATTTTTCCCTTGAGAAGGTGGCAGCGTGACAACAGCGCGCTCACCAACACGTGACCAGCCAGTGGTCCGGGAGAGATAA
AGATTGAAGTTAGTTTCATCCTGAAACACAATCATGTTACCTTCATTGATGTGCTTGTTTAGCTCTTCCACGAaggccttgcgcttggtcttgttggtgg
tggagttcATGGTGGCCTTCTCGATCCGTACGCGCTTGACAGAGTACAACATCCCTTGTAGCGCTCGGTGGATCGTAGACTTTCCTACAGAGATGCCGAG
GTCGCTCAGCAACAGGTCGCGTAGGTCGGTTAGCGTGCGGCGGCAGTCGTCTTCAATGTACTCTTCAAGCTTGCACATTGCTTCCATAGTCAGCTTGACG
TTCGCCGCGCGGAGACCACCATGCTCCTTAGTCTCCTGgtcagcagcaagaacagcCCGACGGGCAGTGCTGTAGTGAACGTCATTGCTCCTGGCTATTT
CTTGCCAGTCTCGTCCTTCTTTATAGGCTCGAACAACGCGGGCCTTCGCCTGCTCGCGTTCGAagcgttttgctgctttctcgGGGTGCGGCTGTGATGG
CATTATTCAAAGTGCGAGTTGCCTGCAAGGCTTGCAGTGCAAGCAAGTATTCTAGCATATTCGAGAAGATTGCAACTTGAACGGAACGATATCGCCGTCT
GGTTTGCACATCGCTGAACGAGTACCTAAATGGACCGGTCATGCACGGACTAAATTGGACTATTTTCATCTTGCTTGGAAAAAAAT