Description :
From Genome Similarity Track
Location :
Scaffold_42:22098- 23592
Transcript NameFunction/comments
Phyke_g2231dicarboxylate/amino acid:cation (Na or H ) symporter (DAACS) family protein

Sequence
1494 bases(100 bases per row)
tcttccacTTGCTCCGCAAGGATACGAGCCACGTACCCGTCTCCTATGACGTTGCACACGGTCACAAAGCGCCCAAGGAACCAGCTAATGGCCACCAGGT
AGCTGAAGCTCGCGGGGATTTGTGTGCTGGGATAAATCGTCGACCAGATGGAATAGATTATCACGACGCTCGCGTTCGGGATGGGGGCGGCACTCATGGA
TCCCAAGACAGACAAGAGAACAATAAGGACGAGTTGAGCCCAGCCCAATTCAACCGAGTTCTCTGCAGTAGCCACCAGGAATACCAACGCGCATGGAAAG
TAGATCGCTGATCCGTTTTTGTGGATCGTGCAGCCGATGGTGaccacaaactgcagcagactTCGAGGCACTTCACGCGAGGACTCTACGCAATGTAGCG
TGACTGGCAGAGTTACCAGCGACGATGCAGACCCCATTGCAAACATGGCTGCCGGAATCATGGCACGCATGAATGCCAGCGGATTTTTTCTGATCATCAA
CCAAAGCAAGATGGGTATGAAGACCAACTCGAACAATGCCATGGAAATGAGGGTGCATAGGACGAGGACACCCACATGCGTAGCAGCGTCCCCTAACATG
GCCTGCGTCGAAAGCGACCCAGCTACCAGTGACAGCACGGCGATAGGACTCCAGTCGCTCACTTTGGCAATGACGCGGAAGAAGACCTTGTTCATCTGCT
TTAGTACATCGAGCAACGGACTGCTCTCTCGGGAACTTGTTTTAACTGCCGCAGCGCCGAATGCGATTGCAAACGTGACCACACTCAATATTCCGCCTTG
CTCAAAGCTCATGAAGATGTTACTCGGGATGAGTTGGTTCAAGATGTCTATAATTTGCATGGacacggtggtggtggagctgccTGTATCCGTCGAAAAT
AGCCCCGACGGATCATGCAGCTGAAATTGAGCTGTGCTATCCGCAGTGGACACGGAGCATGTGGCTGCACCAGTCGAATTATACGTCAAGTAGGTCCCGT
CCTCACACATGATGTTGAAAAGTATCGCTGATTTTTCGCTGGTCAACCCGCGGGCATGTGGGTGGAGGTTGCGCAGTAGCATGGCGATTCCAAGACCCAT
CATTGAGCCAAGTAGCGACAGACCTGTGAACAAAAGCGCCATGCGTGTACCAATGATGGACACTTTGCCCAGCAACACAAGGTCGGCCACTGTCGTAGAC
AGGCTTGTGAACACCATCGGGATCACAAAGCACTTGAGTACTTGCAGAAATACCTTTCCCGGTAGATTTACGAGGTTACCCACGTCGGGGGAGACTTTGA
GGTGCGAGAGCAGTATGCCCAGAAGCAGACCAGCGATTGCGCCGAGCATGATCTGCGTTGTCGACTGTCGGAAGAAGTGGCATCTGCGCACTTCGTTCGG
GTAATTCGTATCGGGTTCCACTGAGTTGTGGTTGAAAAGCTGCGGGTTGCTGACTACGGACTTGGACTTGGAGTAACGAGGGTAGCCTGCGCGC