Description :
From Genome Similarity Track
Location :
Scaffold_97:220919- 223408
Sequence
2489 bases(100 bases per row)
CTTCCTTTCCTGCGTTCGTTGCGAGCGCAGCAATCCTTCCTGGGTAGCCTCCGCTACTACAGTCGTTTCATCGAGGACTTCGCGATCTATGTAGCAATCT
TGTACGAGCTGCGAGAAGTCGACTACCACGCGATGCGCAGTAGGACAGACGTTGTTACCGGGGACGAAAATCAGACCAACCCTGAAGGCACAGCCGAGCA
AGAAGATGGAGATGACAAGTGGGACCACGCGCAGATTGCGTTCGAGCTCCTGAAAAATAAGATCGCCGCCGCACCAGTGTTACGGCACTTCGACTTAGAC
CGAATGCCGGTGCCCGTAGTCTACGCAAGCGACTGGGCAATCTCTGCAGACTTGGTGCAAAATTACGATAGAGTGCACATGTCTGTAACCTTCACCAGTC
GCACGTTAAATACAAACGGGCTGAACTATGGTATGGTCGAAAAAGAAATGCTGGCTTTACTACGAATCTTGGATGTCTGCCATACGATGTTGGTAACAAG
GATGATCAAGGTACTGACGAGATACTCGACGCATTCGATACTGCTCCGATCATCTGGTCTACAAGGTCGACTGGGCAATTGGGCAACGATCTTGTCACCG
TGGATGCTGGAGACCACAAGGTGTATGAAGGGAGAAGACGAAATCTTGGGTACGCTCACAGTAAGCATTACACCCCGCGATAATATCGAATCGCTTCCGT
CGATCGCGCTGAAGAAGCAGCCGCGGCACCCGGTCAAATGATCCCACCTACTGTTGAGCAAGACGAAGAAGCGTTAGCTGTAAGATTTGACGGATCTGCG
AAGCTAAACGAGGTGGTCGCACCTGTAGCGCTGTTGTGTGGACGTTACCTGAGCGGGCCGTCATGGCGGCGGAATCGAAGTATGTGGCTAACCTGACAGT
TAACGAGGCGAAATACCATGGATGGCTTCTTGGTTTCGATCTACTGTCCGGTATAGACAGGGGACGCGTGATCATTTGCGGGGATTCGAACCGGTTATCC
GTCAGATGCGCGGCGAGATCGAGTGTAAGGCACCCGGACTGACGCCGTTTCGGCGACGAGCACTAGACCGTCTAAAATTGTGGCCGTCTCACAAATTCGC
ACATCAAACAAGAGTGGAATGAAAGCGCGGATATGTTAGCCAGCAACGCGTTACAGCAACAAGCAGGCACACGGATTACCTCGGAGGCCGACCGAGCAGA
CCTGAACGTCCTCAGCCGACTGCCGGAGCTACTGTTCCCGAAGGACGAGACGCCAACTGTACGCGTAGCAGCCGTGACACGATCCCGATCGCGTGTGGAA
ATCGCCCAGAAGTACTGTTGTCGGACGGTAACGGCACACGAGAGCGGATCCAATCCGGCAAGCACAAGACGAAAAGAAGTGGATCCCGTATCTCAAGACG
TACCTATCTGGCGACTTGGAGAAACTGAGTGCCGGTGAAGCTCGTACCTGCGGAAAAACCGCCGACGAATAAGAAGTCGACGTGGTCGGACTTCTCTTTT
ATTGTCCGCGCGTAAAGGGAAATGATGCCGATCGCGATCAAGTGGCGAAGTTGGTAGTGCCGGAAGACCTACAACAAGTCGTGTTTCATCATTACCACAC
TAGCCTAGCAGGAGGACACCAGGGAGTCGGAAGGACTTACCGGTGCATCCGATCGCACTTTCACTGGCGCAGCCTGTTCAAGCCTGTGCAGCATTACGTG
GGACGATGTGTGGACTGTGATACAGGGAAAGGTCGCCCAACACTTCAAGAAGAATCGCCAGGGAACAAGCAAGCAACGTACTCATTTCAATGTGCCGCTA
TGGACCACATCCCGTCTCTGCTAAAGTCGCACAAGGGCAGCACCGAGCTGCTCCTTTGAGCTGACCTGTTCTCGGGTTACGTGGTGGCCAAGGCAAGCGC
GTCGAGAGCTGCGCTGACGATCGCCGAGAACTAAGAATAATGTGTCTTCCTCCGATTCGGCGCAAGTGAAATTATCCGGCACGATCGGGAGCCAGGCGTC
GTGTCTGACATTTCCCGCACATTCAATCGCATCATAGGGTGGCTGCAGCGTGCCACTATGTCGTAACGGCCTCAGGCCAATAAGACAGCGGAACGAATGG
AACAGACGCTGACCAGAACGCTGAAGACGTACGTCGCATATGTAAATCAGGCGGGTACGCGGAGCGTTTGACATTCGCCATCAACACGGCACATGACCGC
ATTCGCGGAGCGAAGGCATTCTTCCTGATCCATGGATGGGCCACAAGGTCCACCCTGGAAGCGACACTTGCGCTCGGCAGCACACGACGCCAGGACTCGG
AGTCGCATCGATGGCGCTATAACATCCAGCAACAGTACCACTGGCCCGAGAACATGCCAACGAAGCCTGCGCAAAGCGATCACGGCGAGAACAGATCGGC
AGCGAGCGATTCTGCGACCCCATGGCATCACACCGGTGCTCAGGTGTGGCTATATCTAGATCGTGTCAAAAAGAAGATTGCACTAAGAA