Description :
From Genome Similarity Track
Location :
Scaffold_5:220840- 223298
Sequence
2458 bases(100 bases per row)
GCAGTCGTGGGACACTCTAAAGACAAACCCCGTGTATGGACTTGTCAAGGAATATGCTGACATATTTCCAGACAAAGTGCCGGACGAATTGCCGCAGGAT
AGAGGCATTCGTCACGAGATAGATGTACTTCCGGGAACAAAGTACTGTATTACAAGGCGATGGCCGCTACCGAAGGAACAAGTCGATGCGATCGATGAGT
TCTTCGTGCAGCGACAGAAGGCTGGCCATGTGCGTGAGAGCAAGTCTCCGCACTGTAGTCCCACCTTTTGTGTTAAAAAGGCCACAGGCGGTTGGCGCAT
TGTTCATGCATTCAACAAATTGAATGATGCGACCATACCTGCTCAGACTCCAGTTCCACGAAAGGATATGATCCTTGATGGAATGGTTGGCAGCACTGTC
TTTAGCGCGATCGATCTGAAAGATGGATTCTATCAGATTCGTATGCGTGAGAGTGATGTACCATTTACAGCAGTAAGCACCCCTAGTGGTATGCTGTGGG
AGTGGATGGTGATGCCACAAGGTCTGAAGAACGCACCAGCAACTTTCAACAGAATGGTCACGAATGTACTTCGTCCATTAAGAGAGTTTGCACCGAGCTA
CTTTGACGACATATTCGTTCACAGCAAGGCCTCGGAAGGGAAGAAAGATGTCGATGTTCATCTTGGACATCTTCGTCAAGTCTTTCAAGTAATGCGTGAG
AACAAACTGTACGCTAACTTGAAGAAATGCATCTTCTACGCCCCCGAGATCCCTGTACTCGGTTGCTTTGTTGGCAAGAATGGCGTTCGGGTCGATCCTG
AGAAGGTCAAGTCTATTGACGATTGGCCTATTCCTCAGAACATCAAACAGCTACGTCAGTGGCTGGGTTTGGCCAACTATTTGCACAAATACACGCGCAA
CTACGCAGCGTTAGTGCAGCCCCTCACGAGTCTTTTGAAGAAAGAAAATGAGTGGGAATGGTCAGAGGAACACCAGGCAGTGTTTGCCGAAGTAAAGAAG
AGCTTAAGAGAAGCTCCTGTCCTAGCTCTCACAGACCATGAGAAGCCGTTCCATGTAGTCTGCGATGCGAGCGATTATGCCATCGGGTGTGCACTGATGC
AACACGATGATGAGGGCAAAGAAAGAGTTGTATCGTATCAGTCACGACAACTCAGGCCCGCCGAAAGGAACTATCCAGTCCACGACAAGGAACTATTGGC
CATGAAATATGTATTGGCAAAGTTTCGAGTCTATTTGCTCGATGAAAAGCAGTTCGCTATTTACACTGATCACGCATCACTGCGGACAGCTGTAAAGACG
CCTCACCTATCGCAAAGAATGGCAAGATGGTTTTCCTTTTTCGCTGAGTACAACTTTGTTGTGCATTATAAGCCCGGCAAGTCAAACATTCTTGCCGATG
CACTGTCAAGACGTCCGGATTATGATCCGAAGAGCAAGAGTGACGACACGAACGGAGCGTGTCGACTCTGTGAAGACGTCAACACCATTGCTACGGGAGT
GACAAGCACAATCCAAGAAGAAATTACTGAGGGCTACAAGCAAGACGAAGCATGCCAAGAACTGATCAAGTATTTCAAGAATCCCTCAGACAAGGCACTC
CAGAACCTCCCATCAAGAGCAAGATCGCGTGTTCACCGTTACAGTATGCACAATGAGCTGTTGTATTATGCGGTTGACGAAGGGGATCCAGCGAGGATCG
GTGTCCCCAATGATGAAGGTCTGCGTCATCGACTCTTGTACGAGTATCATGACAGTCCTTCGAGTGGCCATCTCGGACGCGAGAAAACGTTTCTCAACTT
GTCGCGAGATTACTACTGGCCTCACATGTACAAGTGGGTTCGCAAGTATGTGCGTACTTGCAAAGTGTGTCAAAGAGTTAAGCCATCTGGCTCAACTCAG
GCCCCACTTCGTTCATTACCTGTCCCTCAGGACAGCTGGAAGTCTGTGAGTATGGATTTCATATTCGGACTTCCAAGGGACAAACACGGCAGGAATGGCA
TCCTGGTGTTTGTGGACCGATTTAGTAAGATGGTGCATCTTACTCCGGTCTCAGACAAGATCTCGGCAGAGATGACTGCAAAAGTCTTTGTAGACGTGGT
GTTCCGTCTACATGGTCTGCCTTCGGAGATCGTGTCCGACCGAGACACTCGGTTTGCGTCCAGATTCTGGCGTACTCTGTTTGGCATTTTGGATACAAAA
CTATCCATGTCAACAGCAGCACACCCAGAGACAGACGGTCAAACTGAACGAGTGAATCGTGTCCTGGAAGATGTATTGCGCAGCTATGCGACGTCTTTCG
GAGAGTGGAGTGAGTTTCTCCCTCTCGCAGAGTTTGCGTTGAACAACTCCACGCATGTCTCGACAGGTCATACTCCGTTCTATGTGAACTACGGACTTCA
TCCGAGAGTGCCAGCGTCACTAGTAGGCGGAATCTCTACCATAAGTGGGGGAGGGACT