Description :
From Genome Similarity Track
Location :
Scaffold_1018:2207- 4183
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1018-fgenesh-gene-0.1Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_1018-snap-gene-0.5Serine protease family S09A

Sequence
1976 bases(100 bases per row)
CGCTTTCGACGACGAGTTCAATCCACTACCACCACCGCCTCGAACAGATCCCTGAGAGCGTGGGAAGCGTGTTCCACAGTTCCAACACGTTGCGAGTTGC
TGCCCATTCCCTGGCGGTTTATGCAGCGATATCGCTGTCTTCATACGTCTCCTCTCGCTCTCTCTGTCACTCTCGACGTCTCCATTCATTGCCGCAGATG
ATAATTTCATTGGCGTGGTCATTAGACTTGGCATCCGAGGAGAGATCAGTGGGAAGAGTGTTGGTGCCCCACCACGTGGACTTGTGGGGGAAATCGGATC
GTGCCCTGGGTCTTTGCTGTTGCTGCTGCCGTCGGAACGACCAGAGCCAAGCAGTATATTCGACGATTTCTCGAGTCTCTTCTGCAACTTGCGGAGCTTC
GCAGTGATCTGGAGAAACATCTTCCAGCTTGGGTCCGTGTTGGACGCGATGACGTCCTGGAACAGCTGCCGTATCTTTCCCGGCGGTGTATCGAAAAGCG
CTTTGCCTGTGATCTGCTCGTGGATCACGACCTGCGCAAATGCAGTCAGCTGCTTGGTTTGAAGGTACTGCGCCAGCTCCAGCGCGTCCCAGTACGACGG
CATGATGGTCACGCTCCCTTCCGAGTTCCTGCTGTTCTCGCCTGCGCTTTTGCTCTCTGAGGGCCCAACTGCTGCTGTCGATGGCTGTCCGCGCGCTGCG
CTTTTCCATTTCGTGCCGTTTTTGCCCGTGCGGTAGCTTTTCTTCCACTCCTCCCGCTCGCTCTCGACCTTGACTTTCACGCTCGCAAGTCGGGCCTCCA
TCTCTGCGATCTCATGCTCGAGCTCTTGGGTCTTGTCGGACATGGTGCGCGCTCATTCACAGTACGCCGCCGCTAGTCGAATGAAGGAGCACTTGAATCA
AGTTGACAAAGCGGCCCTGCTTGCACGCGAAAAACAAATGGGCGGACCAATATGCATGCTCCTCCTCTCCAGTTGGCAGTAGTCTATATTTACGAGTACA
CGCAGTCTGGGGGGGGTTAGCAAAATAGACATCCACAATTACCTTTTTCTTCTCTATTGGTGGAACGGCAGCTTGAGCGCCTGGTACAGGAACGACATCT
CCATCGCACTTTCTTGGAGTTGCTCGAGGCGCCCGCCGCCGCCAAAGTGGCCGTCATCTTCGCTCACTTTCAGCAACAGTAGCCGTCCCTTGTCATTGTC
AACGCGCTCCTGCTGTTGCTGTTTTGCCTTGAACTGTCGCAGCTTGTGGACCCACTTAACCGGTTCCCAGAACTGCACGCGCATGTCGTTCATGCTCCCC
GTTACAAACATGGACGGGTACACCTGGTCAGCTCGCATGTTCTCGCACGGAGCGTACGATTTGATGTACTCGTACACTTTCGGGTCGCTGCTCGGGTTGC
CCCACTCTTCATACTCATGCACAGTCAGCGGGAGACTTGGGTCCTGCATGGTCTCGAGGATGTCCAGGAACGGTACTTTCAGGATCATGGCTTGGAACAG
CGACGGGTGCTCGTTCGCCATGTATCCCATGACAAGTCCGCCCGCACTCACACCTTTGCCCGCGAGTCGTGTTGGGTTCGTAAACTGTTGGTCGAGCAAG
TGGGTCGTACACGATAGGTAGTCGTCGAACGTGTTGCGCTTGTTGAGCCCCTTGCCGTCGTGATACCAGCGCAGACCGAGCTCACCGCCGCCTCGCGCAT
GTGCTAGCGCGATCACCCACCCGCGCTCCAGGAGACTGAGGTGTTCAAGCTCGAACTGCGCCTCCAGGTTGGTTCCATACGCGCCGTACCCAATGAGCAG
CGTCGGGTTCTGGCCGTTCAACTCAATGTCTTTGCGATGAACCAAAGTCAGTGGCACTTCCACGCCCAGGCTACTGGTGCTTGGGACATACAATCGCTGG
CAGGTGTAGAGATCCGGACTGAACGCTCGCTGGTCGCTGGTGTCCTTGCGCTTTGCTTTGCTCTTGGTGTTCTTGA