Description :
From Genome Similarity Track
Location :
Scaffold_1176:2207- 3500
Sequence
1293 bases(100 bases per row)
TTGTTCATAACTTTGGGGGAAATGGATGAAGGCGCAGTCTTCGTAGTATAATAGAGTCTCGATAAAAACAACACCAGCAAACATTGAGCAAGAAAAGAAG
AGCGAACAACCAGTCAGCGCAGGATAGAGCACGCGTGCGGTATCGGCGAGAGAGAGAGAGAGAGAGGGAAAGAGGAGAGAGAGACGTCGCTGCGTGCATC
GCCTGTACGTGTAGAGAGAGAGAGAGAGAGAGGAGAGAGAGAGAGAGAGAGGAGAGAGAGAGAGAGAGAGTGATCATTCCTTCTCTTCGTACCCGAGAGA
GAGAGAGAGAGAGAGGGAAAGAGGAGAGAGAGACGTCGCTGCGTGCATCGCCTGTACGTGTAGAGAGAGAGAGAGAGAGAGGAGAGAGAGAGAGAGAGAG
GAGAGAGAGAGAGAGAGAGTGTCCAGGTCTTGACGGGTCGGGGTTTCACTTCTCATTCTCAACGACTCCTGCAAGGCCCTGGCTCGCATCCGAAGAGACT
GCATGGGATTTTGCACAGGCATCCTCACTCTCGTATTTGCCGCCAATCCGGCACACCCTGAGGCGGAGCCTTTTCATCTCTACGGCTTGTCAGCTTTCGA
CTATCGATAATTCGGCTTCCGTCCAGGCTTTCAGACGAGCCGCTCCAGCAGACGTCCGTCCAGCACCCAACAGCAGCGACTCGATCTCTTCCCAGGCGGT
GGCGACGAGAGCACCTTCGCACACACACGTGTCCAAAGAGAACTCCGCCTCGACGTTTCTGCGTGTCATTGTGGTCGGCGCGACGGGCGACGAGGCAGCC
AAGTACTTGTGGGCGGCGTACTCCCGGTTCGCGCTGGAAGTGCTGTGCCCACGCCCATCGAACGGTACATCACACACTTTGTGAGAGAGATTCCGCTGCC
GCCGCATGGACGAATCCAAGTGCAGCTCANNNNNNNNNNAAAATCTCATCATCTCTACGAGCTCCCTCTCATCGGTTTGCGTTCTCGTTGTATGCCACTG
GCCACTTATGTGTTGTTCTTACCTGACTTTGTTGTTCTTTGCAGTTTTCTTTACGACCACTCTTCCAAGCACTTGACATCAGCAACGTGCTTAACGTACT
CGCCGAGGCCAGTGCCATTGCTCCCACCGTGTCGTTGTGACGTTTGGATTCCCTTTTGTGGTAGGCGTTCCCGAATGATGAGCACCTCACACCAATCGGT
GATATCGCTTCGGACCGAGGCCGCACCGTCCCGCTCAATAAGACCATCTCTGAGTCCGTGATATCGGACACTACGAATAGCTCTGGTTACTCG