Description :
From Genome Similarity Track
Location :
Scaffold_143:2206788- 2208714
Sequence
1926 bases(100 bases per row)
TCCGCATGATGCGCGTCCTGTACAGCGAGCTCAAGTTGCGGGAGAATGAATGGGCTGCGACAGCGCCGATGGTCCAGTCAGCGCTGAATCACCAACCCGC
CGATCGTCTGGGTGGAGTCCCACCGATCACAGCGTTCCTGGCTCTGCCAGCCAGCACACCGTTGCGCGCTCTCTTCCACCCGCGTCTAAAGGACCAGGCG
ACGGTGGACTGGCTGGCAAAGAGCCAGCAAATGCACCTGCAAGCGGTGGCCTCCGCCCTCGATCGGATGCACAAGGACCGTGTGGCGAGTGCGGCGGCGA
AGCGTGACAGGAAGCGAAAGCAGCGCGAAAACAAACAGGGCGTGAAGTGGCCAAGCCTGGTCTTGGGAGATTACGTGTTGGTAGCTCAGGTGTTCAACAC
CCGAAAAAGCTGACTCTACGCTGAAGGGTCCCTACCGCGTGGTAAGGGTCCTGTCGGACTACCTTATGGACCACCTTATGGAAGTCCAGCAGCTGTGCCC
CCTCATGGCATCAGCGGATTCCACGTGGAGACCCTCAAGGAGATCCGCGATAACTCCGGTCGCTTTGAAAAACTGGTCAAGTGGCTCGGCCTGGATGACG
CCGAAGCCTCGTGGGAGCCCGCAACACAGCTGTATGAAGACATCCCAGTTGTATTTCGCCGCTGGGCGAAGGCGAACACCAAGATGAAAATGAGGTCGGC
GTTGGTTGCGGATATTGAGCAAGCGATGGGGCATTCCCTCTAGGAAGGCAGTGTTCCAGGGGGATCGTTGCCCACGAGAAGTACGTTGCCCTCGCGGTGG
TTCGGACATCCGCCAGGTACAGTACGATACAGTAGGTAGGGTCCGAAGTGTTTGTTCAAGGCGACCAGGCGAGGTGAAGGGGTTGGTAGTCAGTAGCTGG
TAGCTCTAGCTCTAATCGAATGTACTCTTGCTTTTTACGAAGACGGTGAGAGTCAACAGTCTCAGCTCTTCGCGTCACGAGGACCGGGAGTGAGAACAAC
GTAACAAAGTCCTTTTTGGAGCAGTTCTGCACGTTGCTGTTGCAAGACGACAACGTACATTGGCAAACTTCCATGAACTACCTGCGTGCCATAACGCGCC
GACTCGAAGAAAAGATCAAAGTCGACTTGTTTGCTCGAGAAAGTGATTAGTATCGAGTATCGCAGACGACACTTGCACGAAAAGGACGTGTTGGAAAACA
CACAGACAGGTGTTTGTGGCTAAAGAAGCACACGTCGACAATTGATGTAGTTTCAATTATGTATCAAATTGACTTCGCCAAATATGACTCTCGGTCTCTG
ATAAATCAAAAGCGACTGAGCAAACAGTGGCTGTCCATTGCAAGAAGCCTTGACATTGGCAACTTGCTCGAGGACCTGCAATTTTTTGCTGATCGATCGA
ACAAGGTATGACCCATCAAACGAATTCTGTGCTCCCAACTAACACGTAGATTGTAAGTGCGCCAGCAACAATCGACCTCAATCTTTGCTTACCTGGCACT
AGGGCGATGGATCCGTTCCACACCTTGGTCGCTGGCCCGTTCAACAATACTCACAAGGTGTTTCTTCACTGACGCGAAAAACAACTTGTACACATTAATC
GAGTACTCAAAGGGTTATACATCAGATCAAGATTCAACACTTACCAAGCGTCTGCAGTCGGATTCCGCGCGTCGTGGTGGCGCTGCACATGCAAGCAGTC
ACGGCAACATCACGTTGCCCGTCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNN