Description :
From Genome Similarity Track
Location :
Scaffold_74:22063- 74770
Transcript NameFunction/comments
Phyci_232885ADP-ribosylation factor 2
Phyci_30002charged multivesicular body protein 5, putative
Phyci_94709ABC transporter
Phyci_280993predicted protein
Phyci_315541hypothetical protein Esi_0077_0066
Phyci_280997Cullin-associated NEDD8-dissociated protein, putative
Phyci_525945hypothetical protein PITG_01501
Phyci_232973DEAD box polypeptide 20
Phyci_94715Hypothetical protein
Phyci_232875Rab11 family GTPase putative
Phyci_232811unnamed protein product
Phyci_94717importin alpha-2 subunit
Phyci_94720DUF3342 domain containing protein
Phyci_82674conserved hypothetical protein
Phyci_232789vacuolar protein sortingassociating protein putative
Phyci_232731conserved hypothetical protein
Phyci_232962Hypothetical protein
Phyci_94722unnamed protein product
Phyci_315581Hypothetical protein
Phyci_94723hypothetical protein
Phyci_82680fumarylacetoacetate (FAA) hydrolase, putative
Phyci_163690Hypothetical protein
Phyci_94725PREDICTED: ras-related GTP-binding protein A-like
Phyci_82683Hypothetical protein
Phyci_232832malonyl-CoA decarboxylase
Phyci_315591hypothetical protein THAOC_10099

Sequence
52707 bases(100 bases per row)
TACGCCTACTCCATCAGGAAGATGCGGCTGGCGACGTCCGCAACGAGCCAGTCGATGCCGTCTACGAGGCCGTCGCCCGTGACAGCGCTGCAGGAGATAA
TGCTCCAATGCCGCGTGGAAAACTGAGCGGAGCGCAGCCCCAGCGCATCCGCGATCTCGGAGGAGGAAAGCGCACCAGGCAAATCCTGCTTGTTGGCGAA
AATGAGCAGCGTGGCGCCTGCCAGTTTCTGGAGAATAGAACCAGTGCCACAGCATCAGCAACAGGTACTAATACACAACAGTAGCTAGCTGAGAATGAAG
CACACACCTCTTGCGTCAACAGATTGGCGAGCTCACGCTTGCAGTCCTCTAGTCGCCGTCGGTCGGCGCTGTCAACGACCCAGATGAGGCCATCCGTCTG
CCATGCCACGCAGTGTCAGCTCCAGCAGTACCACCCACAGGCACAGCCCTCTCACTCTCCAAACCTGTTCAAAGTAGTTCCTCCAGTACGAGCGAATGGT
CTGCTGGCCTCCGACGTCCCAGACGTTCAATTTGAAGCTGATGGTTGGTCACACACCGCACGACAACGATCAGGACTTGTACCCACCTGCAGCAACCACA
AGTATGGCAGCCCCACACACTCACTCTTTGTACTCGAgcgtctggatgtcgaagcccagcgtgggcgagatctccgtgatgtcctggcccatgaacttct
tgaggatcgtcgtcttgccggcattgtCCAGGCCTCTGCCCGCACAGCAGTAGCGCATCAGCTCCACTCAGCTCCTCTCTCCTTCGTCATCACAGCGCCA
AACGCACAGCATGAGTACGCGGATCTCCTTCTCCTTCTCCTTGACCTTCTTGAGGATACTCAGCAGCCCCATCTTCACTCGCTACCGAATGCTCGATATG
GCGAAATGCTAAAATTGCAGAAATGGCCGCACGAAAAGCGCATGAAACGACGCGACCGCGAGTTCAACTTCTGCAGTGACGAAGCTGCTGCTGTCATGAC
CAAGGCGCTTCCGCAGAGACGATGGCTGCTGGAGAAGCGCGACGGCAACCAGGAGGACGCGCACGCCCCGGAGCCGGGCGCTCGGCCGGCCAAAGTCCAC
TTGCCGGTGCAGCAGCAGCACTCGCCGGACTGGGACGAGGACGCGGAGCCTTTCGAGCGCAGACCGACGTCGCTGGAAGAGCTGCTGGATCTGGAGCTAG
ACCTCGTTCTGCCGGTGACGGCAGTTGCTGCTCCTATGAGCAACCAGGCGCCCGTGTGCGTGGCAAAAGAGGACGAGACCGACGTCGACTCTGTCTCGTT
GGAGCTGCTGGTGAGTGAGCGGACTACTTGTGAATGCGCGAGAATCACCCACGCATATTTGCTTCTTTGCGTTGCATAATGCAGGCTATGCAGAGCCCAC
ACGGCGAGAACCAGCACTGGCAGGGCGAAGAAGAAGAGCAACATGCCGTTCGCAGCGCGGCGTCAGTTCGACCCGAACACTCTCCACGGCGCTGGTTGAA
GGACATGCCGGCCCCTCGGAAGCCCTTACCACTAAATCTCGTGTCGCCGACAGCATTCGTTCCGTCATTTCCCCCTTCTTCTGGACAGTCATCGACAGAC
GATGACTACGGCTTGGCATCGCCCATGGCGCTGCCCGACACACCTTCACAGACCCGATCAGGGATCGCATTAGCCTGGGATCTCGAGCCACCATCTCCGA
CACTAGACGATGCGCATACGAGAGCAGGAACAACTCGTCGCTTCGTGCAATCCAAGAGCGTCCAACGACCAGAACGTCGAGCCTCGGCATCTGCAGTTGC
AACTAGAGCTGCCACGCCAAACCCACGAAGCCACCGAAACTATGGGCCTGATAGAGCAGCGTCAAGGCTAACAAGGTCCTCGCTCCCTACGTTACCAGAG
GTTCGAGCTGGTAAGGCCAGACACGGCGGTATCTACTCGTTGCTACTGAAGAATAAATCTTCGAAACAGGAACCCGTTCTCGTAGAAGACACGCACAATC
CTGAAGGTATGCGCTGTTCGCGTTGCATCCTGGAGAAGATTTTGCAGTCTTAACCCCCGTTTGAACACTGTGTCCGTCAGAGGTGACTGCGGCTCTGTCT
GTAGCCAAGGTGAGTGCAGCGAGATGTTGCCATGCATGCCCTGGTCGCTTCAGGGTGGTCTCACGACTACACCTTGTGCACAGGTCTCTCCGCCTCGCAC
TTTTGGCAAACCCAAGCACGGGGGTATCTACAAAGTGCTTCGAGGCGGCCACGGACCGCGTTAGTCTCCTACTCGAAAATACAAACTGCGTTTGAGCCCA
TTTGAGTGTTTTCTTCTCAGGTTCTTGAGCTCAGGAGCTCTGCTAAACAAAAATGCATGCTCCCAAGTTGCAGTGAAGTGGATTTTTTCCTGATGTGGAT
ATAGCTTGTCGAAATGATCGCACCATTTCGCAACACAAGCCCGAGGACACGCAAAAGATGAATCGCATTTTCGGCAAGAAAAAGCCCGAGGCGCCGCCCG
TCAACATCTCGGATGTCGGGGGCAAGGTGGACGCGCGGGTCACGGGCCTGGACATGAAGGTGCGTTCTACAGCGGCGTGGCTGCTTCGCGGTGGCGATCG
GCGCTAACTGGCCACCGCTCTCCGCAGATCGAGAAGCTGGACCAGGAGCTGCGCAAGTACCGGGAGCAGATGAAGAAGACGCGAGGCCCCGCCGTCAACT
CCATCAAGCAGCGTGCCATGCAGACGCTCAAGCGCAAAAAGATGTTCGAGGCGCAGCGGGACAAGCTGCAGGCGCAGTCGTTTAACATCGAGCAGGTGGG
CGTCGGGAGTTTGGGAAGCGCTATGTGCGCGGAGCTGAATAATTGCATATTGCCTGCCGTGGGACTCGGAACTGTAGGCGGCGTTTGCGATCGACACATC
AAGAGACACAGTCAGCACCGTGGCTGCGATGAAGAGCGCTGCGGTGCAACTGAAGGCGGAGACGCAGAAAATTGACATCTCGGAGCTGGAGGTGGGTTCA
GGGGAAGCAATAATTAGAGGCCAATAAGTTGAGCGCTGACGTGTTCTATCTGTGATGCCAGGACGTGCAAGATGACATGGCAGACCTGATGGAGGACATG
AACGAGATCCAGGAGATCATAGGCCGCTCCTACGGGTACGTGCTCGCGCAAATGCGCTTACACATAACACAAAGCTCCAATATGAACCCGTGCAGATTCT
GACCTTTGTGTTCTTGCTGATACGATCAATGCAGCATCGGCGACGAGATCGACGAGGACGAACTGGAGGCGGAGCTAGAGGGGCTCGAGGAGGAGTGGGC
CGAGGAAGAGGCCCTTGGAGAGGATGCAGAGCAGGCGCCGTCCTACCTCGCGCCAGCACAGCACCACGATCTGCCTGCCGCGCCCTCAGGCTCCTTGGAC
TCCAGTCGGACTGCTCGCGCCACGGACGAGTTCGGGTTGCCTGTGGCGTCATACTCGACGTAGTGCCGCGACGGCTGCAATCAAGTTGATAATTGCGCTG
AGCAAAGAGATCTGCGCGACAATATATTCTAGCACGTCGCAACAGCCATGTGCTCGCGCCGTAGTCGCCGTCTGCTGGGGCTGTCAAATGGGAGAGATGG
CTACACTCCACGTCCGGCGCGTCGATACAAGCCGAGAGAGCCAATCATTTCCCGGAATCAAGTTGGACAGGTGGGAAGCGGGTTCAGCAGGGTATTCATT
TACCAATCCACTCAAAACATCAGATCTCCAGATTATGTTCGCCACACTACTATTTGTTCTTACAGTGCGACGAGGTTTTACCCTCTTCGAGGTTTTATCA
TGCTCTGCGCCACGCATTTGGCTTGGCTCACTTCGGTATTGGTGGTTTTGGTGAACAGCTCTTCGGGCGCCCCAGATCTCAagcagcaaccagcagcagc
agcagcagcagcagcagcCATGGCCCGCGAGAAGAAGGAGCCGCGCGTGAAGAAGGAGCGTAAGGGCAAGAAGGAGTCCCGCAAGAAGGCCGCCGAGGAG
AAGGCGGCGGCCGAGAAGGCGGAGGCGCTCGAGAACATGTCGCTGGCCGACCGTCTGGCCGAGGAGGGCATCATCGCCACCTGCTCGCACAACGTGCGCT
CGGTGCACAAGAACTTCAAGGACATCAACGTGCTCAACTTCAGCATCACGTACTTCGGCAAGGTGCTCATGGAGGAGTGCGACATCTCGCTCAACTACGG
CCGCCGCTACGGTCTGATCGGCCGCAACGGCTCCGGTAAGTCCACGTTCATGAACGTGCTGGGCGCGCGTGGCATCCCCATCCCGGACAGCATCGACATC
TACCACCTCAAGCACGAGATCGAGGCCAGTGACATGACGGCGCTGGAGGCCGTGCTGTCCGTCGACGAGGAGCGCAACAAGCTGCAAGCCGAGGCCGACG
AGCTGTCGGAGCAGATGACGGACGAGTCCATGAGCGAGGAGGACAGCGAGGCCATCTCGGACCGTCTCACGGACATCTACGAGCGCCTCGACGACATGGA
CGCCGCCACGGCCGAGGTTCGCGCCCGCCAGATTCTCTCGGGTCTGACGTTCTCGGACGCCATGATGAACAAGAAGACCAAGGAGTTCTCCGGTGGTTGG
CGTATGCGTATTGCCCTGGCCCGTGCCCTGTTCATTCAGCCTACTCTGCTGCTGCTTGATGAGCCTACCAACCACTTGGACATGGAGGCCGTCGTCTGGC
TGGAGGACTACCTGTCGCGCTGGAAGAAGATCCTGCTTATGATTTCACACTCGCAGGAGTTCATGAACGAGGTGTGCACGAACATCATCGACCTCAACAA
CAAGAAGCTCGAGTACTACGCCGGTAACTACGACACGTACGTGCGCACCAAGGCTGAAAAGGAGGAGAACCAGATGAAGCGCTACAACTGGGAGCAGGAC
CAGATCAAGCACATGAAGGAGTACATTGCCCGTTTCGGTCACGGTTCCGCCAAGCTGGCTCGTCAGGCCCAGAGTAAGGAGAAGACTCTGGCGAAGATGG
TTCGTGACGGCCTGACCGAGAAGGTCGAGAAGGAGGCCACCGGTGACTTCAAGTTCCCCAACCCGGAGCCGCTGCCACCTCCGGTGCTCATGTTCCAGAA
CGTGTCGTTCGGCTACCCGAACTGCCCCGTGTTGTACTCTGGTGTGGAGATGGGTCTGGACTTGGACTCGCGTGTCGCCCTTGTTGGTGCCAACGGTACG
GGTAAGACCACGCTGCTGAAGCTGATCACAGGAGACTTGGTCCCCGTCGCTGGTAACGTTCGACCACACAGCAAGCTGCGCATCGCTCGTTTCAGCCAGC
ACTTCGTCGACGTGTTGGACCTGACCCAGTCGCCGCTTGAGTACTTCCGTTCGCTCTTCCAGACCAAGTCCGTTGAGGATGTCCGCAGCTACCTGGGCCG
CTATGGTATCACCGGCGAGGTGCAAACACAGATCATGGGACAGCTGTCCGACGGACAGAAGAGTCGTGTGGTGTTCGCGTACATGGCGCAGCAGAATGCT
CACATGCTACTGCTTGATGAGCCGACGAACCACTTGGACATGGAGTCTATTGATGCGCTGGCCCGCGCCATTAACAACTTCAAGGGTGGCATGCTGCTGG
TTAGTCACGACATGCGATTGATTTCGCAGGTCGCCAAGGAGATTTGGCTCGTGGAGAACCAGTCTATCAAGGTGTACCAGGGCGAGATCTCGGACTTCAA
GATGCGTGTGCGTAAGCAGCTGAAGCTGGCCGACAAGGAGCCCGTCAAGGTTGCCGACGAGTAAGTGCTCACGACAGCTTACCGCTCATTAGATGCCTGC
TACATGTAGAACTGCAGTGGCGAACACCGCGGCGCGCTGTTCTGTTCATATTTGATTCCCTGCCGACAGTTAACTCATAGATTGAGAAATCTCAAGTTGG
CACATGTTTCACTTTCTACTTAGCTTTACGAGCTAGTCGTCATCCGCTTGGTTGTTGTCTTCGGCATTGCCTTGGTTGAAGTCGTGGGTAGTGAGCCCAT
CGTGGTCAAGATTGATTCTCAGGCCATTAACCGTGCACTGAACAAGTGCATTTCTGCTGTTGGATTCATCGCTTTCATCGTCCGTATCGTCACCATCGCC
GTCCTGACTTCCACGCTGCCGATACAGTGACCCCGACCCGTTTGTGAAGTTGCTAGGTGAAAGTCCACTCGATAGGCGGCTGATCCAGGACGATCCGCTG
GTTCGTCTGAATAGCTGGTGTCGGTGATTCCGACCTGCATTTCTTGCTCGATTGAAGAAGCGCAAGTGCTGGTTGTCCACGAGGACACAACCACAACTTG
CATCATCGCCCATGCCATGGTCCTTGGATGTCGAAAACACAGTGATCACTCGTGCTGAGTTGCTGAAGGACAAACCCTCGCGAGTGGCCTCATGGGCTCG
TATAATGCGCGAGAAACCATACTTCCCGAGAAATGTGTCAATCGCTTGGGCTCCGAAGCGCACGGCAACGCCTCCGCGTGGACTCTTACCGAAGCCTCGG
GAGTCCAGTCTCCAGTTGCTAACCAACTCGTTGCGACCCAACACGCCTTCATTTCGCACGGGGTCACCCCAAATCATGTCTGCGATCATAGAGAGCTGCG
GCTTATCAGCGTAGTATGTAGTGTCCAAAGTGTCCAGTGATGCTGTCGTTGGCAATTTAGCGATCGTCTTGAGCAGGTCCTCATTTCCTTCGACTGGGCG
AGGAATTCCACCGTGCACACAGAAAACATCGTTGTCAATGGCTGCAGCGACGGGAAGACGGTCAAATGCGTTGTTAAGCTGATGCCAGACGACACCGCCT
TCACTAGCGCCGAACCGGGACTTGCATTGTGCAAGCAAGCATCCTGAACCGTAGTGAGCCTCGAGACCATTTACAGCACGCGTTTCGTGGTTGCCCCGCA
ACAAGAAGATCTTCCCTGGGTGGAGAAGTTTATGCGCGAACAGGTAGGCTGTGCATTCTAGTGACGAGCTTCCGCGGTCAACATAGTCACCGAGAAACAA
AAAGCTGCCGGCCGTGAGTTCCAGCCCGAGATGCCAAATGTGCTCCGCGAAAAACCGCAGGTCGGTCCAGTTGCCGTGAACGTCACCGAACACATACACG
GGGCTAGGCAGATCCAGACAACGTGCTTCGCGCTCCAGCAAGCCACCAACTTGAGCACTCATCTCGACCAGGTCCGCGGCAAACTGAAGAGATCGTAAAT
ATGGCTGAGTTGTCATCATCGGATCCGCCAGCGCTGCAAGCACGCGTCGCGCCACACCAACACCTGCTGTAGCTGGAACCGACAAAGGCCGCAAAGATGC
CAAAATTTGCGCCGACTTGATGCTTCCCAGGCGATCGATTCGCCCTGTTGGCTTGACACTAGTGTCCGTGATGGAATACATAGTGGGGACGAGTGTGTGG
ATCGACGATGAAGTTGAAGTTGTAGTCGACACTTGATACGACGAGGAAGACCCAGGCGCATCACTCGTCGTGATAGTTGAACGTCCCGAAGATCGCGCCG
AGGCAAGCTGCTGCTTGAGAAATGCGATTTCCTTGTCTGTCTCCAGCTTTAATGCTACGTACGAATCACGAAGTTTCTGTGCGTGGAGAGTAAATTAGGC
ACACGGGAAGTTTGAACAAATTCACCTCGCGGCGTACCTGAAGCTCTCGAGCGTTCTGTTCTTCACGGAGAAAACAAGCTTGAGTGCAGCACTTGACCGA
GGCAGAACCCGAAGTATTTGTTGGCGGATTGCTCAACGGAGAGCGATCCTGGCCGTGCTGATGAAGCTGATCTTCGAGGCTGCAGTTCATCTTAATCGCT
TCTTCTTGATGGTTCTGGTGTCCACGATGGATAGTGGCGGCGCCCATGAAGCACGGCGCATTTTGTCCGCAACAGCTTCACACGTAATGGACCGGAAATA
GACTCATGGGACGTAACTCCAAGGTGGCCAGCCTCCTGGAAATCTTGGCGAAGGGTCATTCATACCCGTCGAGGATGGTGCCGTTGCGGATGCGGTGGTC
TCTCCTGTTGCTGCTGGGTCTGCTCGTGGCTGTCGTGCCTAGTTGTGAGTGCGGCCGAGCTAAGGCGATCGACTACGAGGCGCTGGAGAAAGCGTGGGAG
GCTGGCGATGCCGAAGTGGAGCTGCGAACGGAGGGGGAAGAGCACTACCGGCGGCTGCAGGACAAGTAAGTGGCATGCTGGCTCAAGTAAAACGAGGGCG
AAGGTGCTCACCCAGTGCCCGACGTGACTGCATTTCAGGAACGAGCAGGAAGCGAAGGCGCTTGGCCCGCAAATGATTTTTGTGACGATGAAGGACGCAG
GCGGTCGATCCCGAGAACCCCTCTCTGACGTTGCATCACGGTGGAAAGAGGTGAGAAGCGTGGAATCGATTGCCATTGCACAATGAACGCACTCACGCAC
TGTTGCTCGCAGATGCTGTGGAATGGAGGGGTTGAAGTGAACATCTATGAAGTCGCCGACTCGAAGCTACTGGTTGGACTGCAAAAGGGAATTTTCGCTC
AGGACGTCATGCGGTTTCTCGATGACCAGCCCAACGTGCAGGAGTACGAGTGGAATGGCAAGGCCTATGCTGGTGGACGTTACAAGCGTGGACACTACAA
GCACCCCAAGAAGAGAGCAAGCAAACCTCGGCGCAAGAAATCAGCGAAGAAACCTGGTAAAGATCCTAAAAATGGCAAACACCCACATACACAGCGGAAA
CATTCTCGTCAGCAATCTCAGAGCACAGACTCAACCAAAGCCAATGAGATGAGAACACCAAGCGACGAACTATGATAGCCCTTCAGCGAAAGAAACAAAT
CATTGAAGTCTTAGCTGGACGTTATTGCTGGAGTCATCTACGAACTAAAACCATTTGCGGTGTTCAGCTCTTTACCACTTTAGTTGCTACTGCGCTCACT
GCGAATTGTTTCCAGCAGCGGACCCAGCATTTTGTTCTTCTTCGCGTTTTCCATAACGTTGTTCAGTCTCGGGTGGGAGTCCACGTCGCGCACAGCGCTG
ATGGCGTCGAGCGTGCGCAATGCGCTGCGAATGAGATCCTTCACACGCTCAACCTCGGGGCCGACCTGGTCCTCCTTCACCTTCTTGTTGATCGTCTTCT
CTAGTGGATCTATCAACGAATCCAACGCACCCACAATGCTGCCAGGCTGGACGTAGCAAATCTTGATCAAGATCTGGTGGCTGAGCATTTGGATATCATC
CTGGTCTCCCAAGCCTCGCTTCAGCTGGTCGAAGAACAGGGAGATGTCCAGCTGCTGAGGCAGCACCTGAATCAGAGTATCCACGCACGAGTACGCAGCC
TTACGAAGAGGAAGGCCATCGTCCACCTTGTGCTTGAACGGCCCAAGATCCACCACACGCTCCAACTTAATTTCAGTCGCTTTCAAGAGCACTGGGAAAA
TACGTTCACGCACATACGGCACCAAATAGTGTGCGTGGTGGTGAGCAGCCGTATTGAGGACCAACAGGGCGGCCCGACGAACGTGCAGATCTTCATCTTC
AAGAGCCGCCAGGAAGGGGTCAATGTGGGCAAAAATTGCATTGACAGCCGGTTCTTGGGCCGTTGTCGTCATGGCGTACTTGAGACTAGTCACTGCAGTC
CAGCGCGACCACACGTCTGCGGATCCGCACAGCTCCGTCACAATGGGCATGATCTTGGTACTGTCCGTCACAGAAAGCTTTCCCATGCATTCTCCAACCA
TATTCCGGACTCCTTCCTCCTGGCGAGAGCTCATCTTCTGCAGAACCGGAAGCACACGGTCCACATACATTGCAAAACCGTGGTGCGGTTTTGCTGCGTG
GTCAGAAATGACTTCGCGCAGGGACGTCAGCAGAAGATAGGAGTTCTCTCCGAGCTCCAATTTTACCATGATGGTATCCAGATACTCTTCCATGTTTCCA
ACGCAAATACTGCCGAGCGAATACGCGGCAGCAGCCTTCACTTCCTCGCCCGCATTATTGAAGCAATTCAGAATGATTTCCTTCACGTCAGGGTACCCAG
CAAGCTTGATCTTGCGACCGAACTCACCCAAGCAGTACAAGGCCAACACGCGGTTCTTTTCAGACTCGGTTTGGGTGATATCACCGACGAACTTTGCAAA
AGCCACCTTACGATTCTCTTCTGTCGTAGCGACACACACACCAGCAACACACCGAGCGATGTTCAGCACCGAGTGCTTCGACTCCTCAGAAGGCGTCGCC
ATCAACGCCTTGAACAAATCTGGGAAGCTACTACCCGGAGAATTCAACTGCGTCAGTTGCGCGAAAAGACCCTTCAGGGAATCCAGCGTGGGGCCCTGAA
GCATGGAGCTGTGACACAATTCGAGAGCCTTCACTTGAGCATTTTGCAGCAGCGCATCCGTTGAGGCGACATGCGGACACACACGAAGCGAGTTCGACAC
CAATGTGATACTCATGCGGCACAACTGAAGGTCCACATCCACAAGAAGAAGCGAAGCTTCTAGCACGACTTCACAGTGTAGCGTCTCGGGCATGTTAGCA
CCCTTGTGGACGACCAGATCATTTAGGGTAGCCAGTGTTGCTTGCTTCAACGTGCGAGACTGCTGACGCAGCAGCTGGGCAAGAGTCTGGGTGCACTCCA
CGAGAATAGGCGACATATCCAAGTTGAGCTTCGAGCGTGCAATGACTCCGATTGCCTTGATGCTTTGAACGCGCGTGATTTCGTTGTTCAGGCGCTCCAT
CAGCAGAGGGTAAACTTCACCCACACGAGGCCCAAGCTCATCACCTAGTCATAATAGCAATAGGTTAACTAATCAGCTCGTTGGTAATGTCCCCATATCA
ATCGTTACGCACCCAGCACAGCAATGATTTCCCCAATACTGCTAATAGCAGCCTCCTTGATTTCTTGGTCGATGTCGTGAACCTTCAAGCTAGGCAAAAC
TGCTTCGAAAAAGGGTACCGCGTACGGTTTGTACGTCACGTCTCCGTCGTCGGAACGAATAATACGGACGAGAGATTCGATCAAGCCCAATGCCTTTGCA
ACTGTCTTGTACCAATCTCCCTTTGCGCACTGCACGGCAACTTTAACAATTGACTCAACGTGCAATCGGAACGGTTCCACGGTGTGCGTGTCAATGAGTA
GTCGAAGGAAGAGTAACGCATCCAGCTTAAGATCTGAGTGCTTGTCTTCCACCGCATTCAGAATGTTCGGCATTAAACGGCCGATGAAGTCCCCAAGCTT
TCCATGCTCCACCATTGCGAGCTCGCTTAGCATCGCGACCACAGCACAGCGCGACGGGACTGAAGCCTTCGTTCCGAACTGTTTGTTAGCTCCAACAACG
ATCGTATTTAAGCGCTGCTCCAGCTGAGTAATGCACCCGTTCGACGTGGGTGGGTGGAAAGAACCAGCTCCGTTTGAGTTTGGAAGGGTCTTACGAGTAG
CGCGAAGAAGCTCTGCAAACACCCCAAACACGTCGATCCGAACGTTCTCTTCACGCTCTTTAAACCGTGAGATCAAAGTCTGGGCACAGTGAATGTAGAG
CTGCTCCAGAAGCTCCGGTCTAGTCGTGATAATTGCAGTCAAGACTCGAAGACTCGCGCGACGAACCTTCCAGCTCGTGTCGTCGTCATCACTGTAGTCT
CCTTCTTCATCACTGTACTCCTCTTCTTCTTCCTCCATGTCTTCGTCCTCGTCGGCTGAGTCAACGTAGTTGTAGTTCGGGTCGTACGAGATGAACTGCA
TCACAAGTTTCAGGATAGCTTCCACGTGTGGTGTGATCTCGTTGTGACAACGGATGACAAATGCTTCAAACGCCTGGAAGCAGTTCCCACGGAGCTCGTC
CGAGTCTTCGTTTTGCAGCGACTCATCTTCCGGATCTCCGCAAAACTGCACCAGGATGCGGATCACGGCGTCCAGGTGCTGTCCGAGACGGTGGCCTGCC
GTGCGCGAGAGCATGCCGATCGTCTGGATGAGCGTGCGGACATTGGCCGAGTCGGAGGATCCCTGAATGCCCTTGATCAGGTGCTCCACCAGGCGGCTCA
CCAGCACATCCGACGCCATGACGCCCAGCGAGCCAACGCAAGCGGTGGCGCGCTTGCGTACAAGGGGCGACTCGTCCGTGAGCTGCACCATCAGCAGCTC
CATAATTGTCGCGTGCTCGGTGGCGACATCGTAGCCGAAGCGGCGCAGCAGGTCCGTGAGGATGTCCAGCGTCTCGGCCTTCACCGCGGCGTCCTTGTCC
TTGCCCAGGCCGGTGAGCAGCCGCGTGCAGACGCCCGTGGCGATGGACGCCCCCGTGGGCTGCGACACGTCGGCCACGATGGTCTTGAGCCCGATCGAGT
AGATGTCCCGCAGCTCCGGCTTGCCGTTGAGGATGAGGTCGCAGAGCTTGGCGCAGATGTCCGCCACCTGCGCCACCTGCACCTTGGTCACCAGGATGCC
CAGGCACTTGACGGCGATGGACTGCACGTCGTTCGACTTGTCGTCCAGCTGCTTCAGCACCGCCGCGCACACTCTGCACACAAAGACACACGAGCGTCAG
CCGCCTCCCCTCCCGGTCTCCCTCTCTCTGGCGACGCACTTGGGCTCGAGGTACGCGCCCAGCTCCGCGTCCTTGTTCAGCTCGACGCAGAGATCCGATG
TAGCCATGTAGCGCTCATCCTTGTCGAAGTCCGTGGTCTGCAGCGAGCACGAGAGAGAGAGAGAGCATCAGCACCCATGCAGACAGCACAGCCAGCCAGC
CATAGCGCACCTTGTCCAGCAGCTGCGAGATCTTCTCCTCGTTCACGCGCATGGTTCTCTCCCCAACCGCGTCGTCCTCGGCTTCGCTACTCCAAAGTGA
AAGTGAGTGACGAGAGGAAGGATCTCGCTGTGGTGTGGCGCACACAAAATACACCGCCGACCGTTACTTCAACTTCAGTCCGCAATTGGCTCGAGTGACC
GACTGAGTGACTGACCTGCCCGGACGCCGACGCCCATGAGTGCGACGAGCTGAACGGCTTTAGCTTGCGATGGCGAGTACTGGGCTGACGCGTTGTGGCT
CTGTGTGCAGGCGAAGCAGAAGGCGGCGGCGGCCAGGCGGCGGCCGACCACGACCAGCTCACGTCGCTCATCTCGGACGAGGTGGAGCGCCAGCTGCGAG
AGCGCGGCTCCGTGCTCGAGGCCATGAGGGAGCAGATGGCCAAGGTGCTCGCCGAGTTCGAGGAGGTGGCGGCCAACGTCAGCTCCAAGCGCTCGTGGTC
CAACAGCGTCGCCAAGACGAAGCCCTTCGCGTCGCCCAAGCGGCCGGCGCCCTTCGAGATCCACCCCGTCGTCACGCCTCTGGACATCGTCCCGCAGCCT
GCTGTGTCGCCTCCGCGGCTGCCAAAGTGAGTACATGGTAGCGGCAACATATATATCTACTGGTTCTCAGCGCACTTGATGTCGTTAGGCTTGGCGGTGG
ACTGCTCAAAAGCATTCACCAGCTCAAGCGGACTGCTAGTGGAGGGGCACTTCCTCCAGGGGGACCTCGCAGTCCTGACGGAAGACTTGCGTTCGGTAAG
ATTGCTCAGGGCTTAGTTGTGTTCGTCTGAATTGTATCTCCTGACTGCTTCGTTGTTCGCCAGATAAGATACTCCCTCGCGTTGCTAACATTGAAAAGCG
CGTCGATGGGTCTCAGATCATGCTTTCGCAGCAGCGACAGCAAATGTATGAGCGAGCTCTGGTACGATATCCACAGTGTCGAAGCAACGTGTTTGCTCCG
AGTATTTACGATCGCGAAGAAACGTCGAACTTGGATTCGAGCGCTGGTGGTCAGGCACCGCGAGCAAAACTAGAGCTGGACTTTGTGTATGGGTGCCGAA
GTGGAGCCACTACGTCGCTTTCCAGCAGTCACCCTGCAGCTCCCAATGCTAGTACCAACAATAATGTCTTCTATTTGTCAACTGGGGAAATTATGTGGTT
TACTGCGACGTTGGTGGTTCTGTACAAGAAAGAAACCAATTCGCAGCGGTATTTTCGAGAACACACAAACGAAGTTACGAGTGTGACAGTCCATCCAAAT
CAACGCATTGTAGCATCGGGGCAAGCGGGGCGGTCAGCGTTCCTTCTAGTATGGAATGCGAACGATGAACCGCTAGGAAAACGATTCGCGTGCCTCAAGG
GCCATCAAGTCGCAGTTCGCTCAATCAGCTTTTCTCACGATGGGAAATTGGTTGCTTCTCTGGGAGGCGATATGTACAATACCATTTGTATTCACGACTG
GAAGTCACAGGAACTTCTGGTAAGCGCTCGAGGGCACACATTTCGGGTGAATGCAATTGCATTTAATCCATTTCAGGCGTATGGTCGCCCAGAAACACAC
CGATCAAAGAAACCTGGTCAAGCTTTGCACGATGACGATGCTTGTTACACCTTAGTTAGCTGCGGTGTTCGGCATATTCGGTTTTGGACGCTAACGAAAT
CTGATTATGTACCCCCGCCGTCGAAAGAAAACGCTGATAGTGCATTTTCCCGTTCCACGTTTGGTGGTCCTCCCAGGCTACGTCCTCCCACTCCGACCGA
GAAAGTTTGGAAGCTGGAGGGCAATGTTCCGTCATTTCATGGGCGTTTTGAGGTCCAAGACTTCACAAGTTTAACATTCATTAACGATTCTCCGCCTTTG
TACTTGTATGATGAACACTCAAAAGAGTTGATCGCGACAAACTCCACTGACCATTCACTGGGCCGAATCGTGGCAGGAACGGCGCGAGGAGATCTGTGCT
TGTTCCTACAACCAAGAGCGAGCCCCAACATCGAAATTCTTTCCGAAAAAGACCTTCGGAAAGAGCCTGCAAAATGGTGGGAAATTCCAGATGAGTACAC
AGACGCGGAGATCAACGAGCTCGTACTAGAGAAAATAATGTACGAATCGACAGGGAGACTCGTCGATGTCGTGCCTCACGATCAAGAAACGGGTAATCGA
TTCAAATTGTCCAGACAAGCTCAAGCAGAGATGGAAGGACTCTCAAAACGGATGGTGCTGCGACCAAACTCCACCGCCTTGAATTCTCGTCTGGGAGAAC
TGAAATATAGTGGCCCGTTAGCTCACCAAGGAGCAGCTTTCCAAGTTGCGTACTGCAAAAAGCTCAACTTAATCATGTCGTGTGGTAATGACGGGAAGCT
ATTGCTATGGACGTGTCAAATGAGTAAACCTATGCGAATTCCTGGGGTTAACACGCATGGAGTGTTCACACCACTAACAGGGACGTTCAAGGAAGGTTCA
CATGCACTGCTTCCTCATGGGGATCCAGCAGAAGTATTCCAGTTGCCGACTGTGCTACCAAATGAAACTAGTGCAGGTGGTGCTGCTGCTTCGGCAAAGC
CAACAAGTATCGTGTGGAACGACGATGGCAGCTGTGTACTTGTTGCCACTAGCAACAGCTGCATATGGGAGCTTCATGTTGCAACTGGAGATTGGCAATT
GATATTTGAAACCCGGAGTAGCGCGGTTTCTGCCTGCGCTGCTCATCCTATGGTACAAGAGGCAGCAACAGTGTCACAAGATGGATACCTTTGCGTTTGG
GATCTTCAGCAGCATATGTGTACGCGTAGGTTGTACCTTGGGACTTTCATAACCTCAAGCGTTAAAGCATTCTGCATGGAGTTCCATCCGACTGGACACG
AACTGACAATTGGTTTGAGTTCAGGAGAACTCTTAATTGTAGATTGCGGCACATTCAAGGTTTCATTTCGAAAGAACATCAAGTCAAACTCGGGTAGTAC
TACCAACTTGCAAGTAGGCCTTTCTGGCCCCGGATTTCGAGCGATTGCACAGGTGAAATATTGCCCGAATGCAAAGTACTTGGCTGTCGGTGTGAAGGAC
ACGTTCGTGTACATCTACGACGTCGTGAACGGATACAAGAAGCTTCATGTATGTGAAGGACATTCAAGTGCAGTCATGCATTTAACGTGGAACAAGGATG
GGGACATCTTGCAGAGCAACGCAGCCGACGGTGAGATTCTTCATTGGCTCGTTTCTCCGAACAAGGGTGAGACCAAGCAAATTACTGATGCATTCCTAGT
CCGCGATGTTCAATGGATTAAATGGACATGCGTGTTTGGATGGTCTACACCCGGTATCTGGTCTGAAGAATCGCCCAACGTTGTGGATATCGCAGCAGTA
TCAACTACAGGACCAAAAACTTCAAGTGAGTTTAATGAACCAGGAACAACTCGAACAACTTCCAGTGAGGATTTGATCGCTGTGGCATGTCGATCGAGTG
TTCACCTGCTGAAATATCCTGCCCACCGCGGAGCAAGGAGGAAAGTATACAAGGCCCATTCGTCGGCCATTGTAGCATTAGATTTCTCATTCGACGACTC
CTACTTGGTTACTGTTGGTGGAGACGATGGAGCGATCATGCAATGGAAGGTGTTACCTGGTGGCGAAGCCTCTCCCCGTGGCCGAGCGAAGGGTGTTCAA
AACAATACGAAAGGCATACCGAAACTTCAAATGTCGGAAGACGATAGCACTGGGGAATCGTGGCCAAACTCGAGTCCTGTGCCACCTCCACATGATGAAA
AGCAGCCGGCGAGCCAACTTTCACCGAGAAGGATTTCTCGACAGTATCGTGAACGTCAAACTTATCGAGAAGCTGGTCTAGGCGAAATGGACTCTGACCG
CGAAAGCCTGCACCAGAATGTGGCGCATGACACTAACTCTCCAGGTAAGCGTGAAGGTTCCAGTGGTGGCGCACCAGTAGATCGCTACCGAGGTCCCGTC
GATCCAGGCGATTCGTTGCCTGCCCCAGTCCAAGTTCGAATAACCCACGACTACGCAGCCGAGAACTCGGACGAACTGAGTCTTAACTACGGCGAGATTC
TGCGCGTGCTCTCGAAAGCTGGAGGCGAGTGGTGGCTAGGCGAAACGTGCGATGGTACCAAAGGCTATTTCCCCGCTAGTTACGTAGAAGAAGTTGATCT
CAGCGTCCCCATTGCCAGCAGCGAGGCGAATGAGGAGCAGGTAGCAGAAGGCTAAACGTCCACCATAAGTTTCTATCCCACAAGCTGGAATCGCTACAGT
GTTTCCTGTATCTTAGAGACACCGGTGAGAGGCTATCGCGGCGTTGAGCGACGGCGGCACCCCATTTGATACTTTGCACTTGTTGAAGTTGTCTGCGACG
TTTGAGACGAGATGGCTACAGTTTCGGTGGTGCTAGTCCACACACACTGTCCCCGAACCATTGTCAATCATTGCAATGGCGTCGGACACGGTGCTGGCTG
CCAGCGCGACGACGTTCAGCGACCTCCCGCTGCATGGAGACGTCTCTCGGGCTCTGGGCGCCATGCGCTTCCTGCGGCCGTCGCCCATCCAGCTGCACGC
GCTGCCCGTGGCTCTGTTCGGCAACGACGTGGTCGGCCAGGCCAAGTCTGGCACAGGCAAGACCGCCGTCTTCGGGGTCACCGCCGTCGAGCACGCAATC
CGCTTCGTGGAGAAAAGGTGCCAGGCGGGTGAGGGCGAGCAGATGCTGTCAGTGGGAGAACCGTTGGCGCTGATCCTGGCGCCGACGAGGGAGATCGCGG
TGCAGATCGAGACGGTGCTGCGTCAACTGGCGCAATTCCGACCGGAGCTTGTCATCCGCACGTGCATCGGCGGCCTTCCTGTGGCTCAGGACCAGGTACT
AGGAAGAACCAGGGGAGGCGGTCTTGTGAGTGGAGATGCTGATTGCGTTGGACGTGTTGTGGGTGGCAGAGGCACTTGGCAGCGGGCTGTCATATCGTGG
TGGGCACGCCAGGACGCGTGAAGGCACTGATCGATCAGTGCTCGCTGCCTTGCAGTGCGATTCGACTGCTGGTGCTGGATGAGGTAGACAAGCTCATGGC
GCGAGATTTCGAGAGAGATGTACGAAGCCTCTGGTGGTTGGTGGGCGTTGACCTGGTATTGACTGTGGTTGTATTTCAGATCCAGTACATTGCAGACGCT
CTTCCTGAAAGGCGGCAGGTGAGCTGCGTGTTACAGTGATGTTCGTTGGCCATTATTAACTCTCATCGTATACTGCTGAATACAGACCCTCGCCTTTTCA
GCCACATTTACGCCTGATCAGTTGGTCGCCGTTGTGCAGCTAACGAGGACGCCGCAGGTTTGTAGATGTGCAGCCAAACTGCCCATCTGACTGATATCAG
TAGCCAACTTTTTATTATACCACAACTTTGACGAGCAGATTGTGAGGGTTCGAGGCCCGAATGATGTCACTACCGAATTCATTTCCTCTACTGAAGACCT
AGAAGACTTGAAGGAGCGAGAGCAGGCGAGCGCCCCGGAACTTTGGCTACGTCACGTGCGCCAGTTTTACAGCGTTGTCGAGCCCTCAGCTGCACAAAAA
TCCGGCGATGATGTGCTGAATATGAAAGCGAAGGTGGTGAAGCTAGCGGCGCTACTGTCAGAAATCGTGTTCGTGCAGTGCATGGTGTTTTGCAACGACA
AATTCCGCGCTGAGGCGCTGGCCACAGCGCTTGCTGCACAGGGCTGGCCAGCAGCGTGCATCACTGGGTCGCAGACCCAAGCTACCCGTTTGGAAGTGAT
GGAAAGTTTTCGGGCATCTCGCTCGCGTGTGTTGGTATCTACCGATCTCACTGCGCGAGGAATCGACGTCGATAAAGTGAACTTTGTGGTACGTCCTATC
CTGTCATCAAGTAGGTCATCATACCAACTTTTCTAAGGCTTCAACCATGAACTCGTATAGGTGAACTTGGATCTGCCGCGTGATCCAGCAACGTATCTGC
ATCGTGTTGGCCGGACTGGTCGCTTTGGCGGCAAGGGCCTGGCAGTGACGTTGCTGTCGAAAAATGAAGTTCAAGGGCTTCAGCTGCTGGCACGAGTATT
CAAGATGAAGATCAATGTGCTACCAAGTCCAGTACCCGCAGAGATCTACACGTACGCCACAGACAATGGCAATGACGAGGATCGTCCAGAGTCTGTGGTT
GAAGAAGAGCATTCAGACGAAGAGGGTGACATTTGTATTGCTCATAGCGTGCATGACGACGAGGTCATGATCCCAAATGGCGAGTGGCAGGCAGACAATT
TGTCGTCGAGAGAGATTTCAAGCCGATACGAAAGGGAGGAACGCTCATACGAAACTTGGATAGAGTTGCTGTAGATGCATGTCGGCAATGAAGCGGTCGA
TCCAGCTCAATCGCTGAGCGTAGTTCTTAGCCAAATTTCTTCGCAATTCGGCGCAAGGTATTCACCGTTCGAACCGTGACGGGGACGCCGAGCTTCTTGT
CGAAGGCTACCTTGAACAGCGGAGACTCGCTCATCTTCGTGACCGAGTACCACACGAACTCCTTATCCAGCAGCTCGAGCTCGTCCGCGTCCGTGGACAG
AGCCTCGAGGATGCGCCGTTGCTCCTGGGTCAGTGTTTCCTTCACCAGCACCACGTTGACAGCCGTCGCGGACTTGACGATCCGACCCCCGAGCTGAGCC
ACCTCGTCCAGGGAGCGGGCCAGCACCGGAATGTGGCCGCCGAAGAGGTCCTCGAGCGCGGCCTCGACTCGGTGTTCGACAGCGAGCACCGAAGCTCCGT
CGGGCGCGTCAAATACGACGTTCCCGCTGGCCAGGAACGTCTCGACGTTGGACAGCCCCGCCTTGCCCAGCGCGTCAGCGATGGCCTTCATGCTGTGCAC
GCGACCCCCGACGTTCACCCCGCGCAGGAACGCCACGATCTTGTGGCTGTTGCTGGTGGCGGTGGAGCTCTTTTCCGGTGGTGGAGCTTCGTCGGCAGCA
TGCGCTGGAGGCTGAATGTCGGCAGTGACAGCAGGAACAGCAGCATGTGCGCTGGAGCGCGTGACTCGCTTGGCCTTGGGCGCCGGAGCGGCTGGAGCCT
TCCTCTTCTTGGCCTCAGCAACCATGGCGTGCAGGGGCGGTGACTTTCAGTATAGGACGCAGTGGCGATGCGAGTGGCTGTGTGGACCTCCTCCAAGCCA
TTGCCTCTGCCAAGCGAGCATCCAAAGCGGAGCTGCGCGAAGCAAAGCGCCCTGATTGTCCTCCGGCGTCCACACACGTCCACCCCGTAATATATGCTGC
ACCTGTTATAATAAGAATACTTTGTTATAAAGTTCCACGATATTTAACACATCTTTTAGTTCGTTCGGCCGAATCACCCTCTCTGTGATCACCCGCCCAA
TCCAATATCCGCGGTATTACGCCGTTGTTCCGCCCTACCGCGGCCACCTCGGCGCATAACCGAACTCGCCGAAGCTTCTCGCTTCAAGCGGCTCTCTCTC
TCTCTGCCGAGGCGTCGCCTGCGCTCTTCGTCGTCTCCTGCGTCACACCTGATCTTAGCCGCTCCCCGCCACCGCCTCGCCATGACCACGGGCAGCAAGC
CGTCGTCGTCGGTGGCGGCCACCGCGTCCTCCTCGTCCTCCTCCTCCGCCGACAACAACAACGCGGCGGGCAACCCGCTGCACAAGTACATCTCGGCCAA
GGAGGTGGCGCAGCACCAGGTCTTCCGCCAGCAGCACGACCTGCGGCGCTCCATCAGCTCCACGCAGTTCAGCGGCGGCCGCGAGAGCGCGTCCAgcccc
gccgggcccggcgccgccAAGGCCTCGGCCGGGGCCATGTCGGCGTCCAGTAGCCCGCGCTGCTTGTCGCCCACAGCGTCGTCGCCCATGGCCGAGTCCA
TCCTCAAGGTGGTGCTCATCGGCGACTCGGGCGTGGGCAAGTCCAACCTCGTCATGCGCTTCACCAAGAACAAGTACATGCCGCACAGCGTGCAGACCGT
GGGCTTCGAGTTCGCCACCAAGACCATCCGCGTCGGCGACCGGCGGCTCAAGGCGCAGATCTGGGACACGGCCGGCCAGGAGCGCTTCCAGTCGCTCACG
GCCGCCTATTACCGCAACGCCGTGGGCGCCATGATCGTGTACGACATCACGAACCGCAGCTCGTTCGAGCACGTCACGGGCTGGCTGGCGCAGGTGCACG
AGCACTCGCACGAGAGCCTCGTGCTCATCCTCGTGGGCAACAAGTGCGACCTGGCCCACCTGCCGGAGAGCAGAGAGGTGTCCACGCTCGAGGCGGCAAG
GTTCGCAGCCAAGCACTCGATGGAGTTCTTGGAGACGTCCGCACTCGACTCAACCAACGTCGTCGACGCCTTCAAGAAGCTCATCGTTCCGGTGGGGCGC
CTGCTGTCCCCCACAGAGCCCAAGAAGATCGCGCGACTACCGACAGGCTGGAGACGCGTGCTGTCAAGGACGAGGCCGGGCGAGTACTCGTACGAGAACC
AGTACACCAAGGAGCGGATCTCGTTCGCGCCCAAAGAGCCCGCCAAGCCGTCCCAACAGAGCTTCCGAGCGCCTGCCAATGGGTCCAAGAGCGGATCCCC
AAGTGTCGTCACGGTAACACGCGAGAGCTTGCAGAGGCAGCATCAGAAGGCGTACCTCGCACAGAACCAGACCCCGCAGTGCGGGGTCTGCACATTCAAC
TGCACCATAATGTAGTCATCGAGCAGACGATGGACGGCTTGCCTCCTGGTCATCAGGCCGCGGGCAACCCGTCCTTTTCCCTCCACCAAGCCAACGTACG
TCAATTCCAGTCTGCATGCTGACCCAAAACAAGATGAAACCAAGTCAACGACTGTACGGAATAGTCGCAACAATGAAGATGAAGGGTACAGGGTCGAATA
GAAGCAGGCTCGTTGCATTTTCAGTTTAAGGTCGTGCTACTGCTTCGGGTGCATGCGGGCCGGCAGGGCAGCGATCTCTTTCTCACTAAAAAGTGCCGAC
GAACCTTGACGATAATTTATTCCCCGAATGTTTTTTTGCAATGTTTCTCTATGTAGGTCCATACATGATGGTTAACTAACGACGCACTGCCGCTACTACC
GCACCACTATCATCCACTACGCTATTTACTTCGAGCGGCGAGCCACCAAGAACGCGGCAGCGACCGTCGCAGCGGCGAGCGCAAACGTGGCCAGCTTGCA
CTCAGTGGGGGCCGACGACCACAGGCTGAAGCAGTCGCCGCAGGCCTTCTGGTTCTTCTTCGCAATGGTCTTGCGGATGTGTTCGGCCACGGTGGCGCTC
GAGTTGTTGGCAACCGCTAGCCGGGTGGGGAGCGACTCGAGGGACTTGAGGATCGGGTGCTGCTGGATCTCAGTCTCGGCCACGCCAAGAGCCTTCGACA
CAACAGGCAGGAACTTACCGTAGTGCGCCGTGCCAACGACAACCACGGCCGAGTTGGGCTTGTCGGTAAGCGCGTCCTGGCCGTAGTGCATGGCAGCAGC
CGCGCCGATAGCGCTGTGCGGATCGTAGAGGTAACGGTGCACCTTCTTGTACTCGGCGATGGTGGAGCGCACCTCGTCCTGCAGCACGGCGTACGAAGCC
ATCTCGTCTTGCGCCTTGGTGAGCAGCTCGCCCGAGATCGTCAGCTCGTTCGTCTGCTCGAAGCCCTGCATCCAGCCGCGCAGGATGTCGTGGTTCTCGC
CGCTCAGCGCGAACAGGTAGCGCTCAAAATTGCTGGACACGCAGATGTCCATGGACGGCGAGATGGTGTGTTCAATGTCGCGGCGGTGGTACTTGCCCGT
AGAGAAGAAGCGGTGGAGGATGTCGTTCTCGTTGGTGGCCACGATGAGCTTGCCGATGGGCACGCCCAGCTTCTTGGCGTAGAAGCCGGCGAGGATGTCG
CCGAAGTTGCCCGTGGGGACCGAGAAGGCGATCTCGCCGGTGACGCCATGCTCGCGCGCGCGGAAGTAGGCCCAGACGTAGTAGACGATCTGCGCCAGGA
TGCGCGCGAAGTTGATGGAGTTGACAGCACCCAGGTGGTACTTGGCCTTGAAGTCGGCGTTGGCGAACAGGTCCTTGACGATGGCCTGGCAGTCGTCGAA
CGTGCCCTTGACGGCCACGTTGTGGATGTTCTCGTCCAGCACGGTGGTCATCTGGCGCTGCTGGATGGCGCTCACGCGGCCCTCGGGAAAGAGAATGAAC
ACCTCGACGTTCTCCTTGCCGCGCAGGCCGTAGATGGCCGAGCTGCCGGTGTCGCCTGACGTGGCGCCCACCACCGTGATCTGGTCCTTGAGTGCGCCCG
CGGGCAGCGCCTTGTTCTTGCGCTGCAGGAAGAACTCGAAGAGGTTGCCCAGGAACTGCAGCGCGATGTCCTTGAAGGCGAAGGTCGGGCCGTGGAACAG
CTCGAGCACCAGCATCTGGTCCGTCACCTTGACTACGGGCGCCACCTCCTCGGCGCGGAACGTGCTCGAGTTGTAGCTCTTGGCCACGAGCGCGCGCAGC
TGGGCGCGGGAGATCTCGCTCTCGTCGATGAAGAGGCCCATGACCTCCGCGGCCAGCTCCTGGTACGACAGCGACGCCCACTTGTCCAGCGCGTCGGCCG
GCAGCGTCGGGAACTCGCCGGCCTCGGGCACCAGCAGGCCGCGGTCGGCCGCCAGGCCCGTGAGCACCGCCTGCTCGAAGCTGAGGCCGCGGACGCCGCC
GCGCGTGCTGCGGTAGTGCACCATTGTGTCTGTGAGGGTTGTAGCGGGGTGTGGGGCTGTCGGGGCGAGAGCGCAAGTGGCCGAGACAGTCGAAGGCTCT
GCACGAGACGTGGGCCCAGGAAACTTCTTGCAGTGCACGTGCGTCCTTGGTGCCTGAGGATGGCGCAACATTCGCACAACCTGCGTGTTGCGCAAACGGT
GGATGTGACGTGGCACGGATGTTGCGCGTCGTGTACCGCACTCCAAACTTGACCCAGCACATCTTCAACGTGAGCAAGATACGATTTCTGACAGCGCTGA
TAATAAAAAAGCAAACAGGGGAAATACATTTCGCACGAGTACTATCTCCCCGGGTCATTCCACAGACTTCTCTTGCATCCGTCCATTGGGTCAATCGAAT
CCGTTACTGTCTAGCTCATCGTTTCCTGATCCATCAATCAGTTCTGGCCAAACTGGAACATCGTGGGCTGGTCCGAGGATGTGCCAAACTGGAACTGCTG
TGCGTTGGCGTCCGTGTCGGGGGCTAGGCTATCCTCCGCATCCTCCTCGCCGTTGAAGTATGCCTCCACAATCTTCATGGACTTCATGTAAATGTCTGTC
ATCGATAAGCAAACCAGTGAGTAAGTAAGCGCCAATATTTGGTGTATACGATGCTGCGCAGATCAGCGTACCTTCGTTGGCGTGGTACTGCAGCGCCTGA
ATCTTGTTCACACCGTCCGCTTCATCGATCATCGTCGCAATGTCGTTGATGTCGTTGGTCTTCTGCTGCTCGCCCACACGAAGAATGTTCTCGAGACCCT
CCAGAGCCACGATCACCACCTTCGCGTCCTTGACCTCCAGCAAATCGCACAGTGGCTTGATGCAACCTGTGAGCAGCAATTCAATCTGCGTTAGAAAAAA
AAACATAAACGCAATACAACCACAGGGACCATGCACATACCAAGGCTGACAAGGTGCATGATCTGCTCCGCCGAACCACCAGACGTAGCGTTCGACACAG
CCCAGGCAGCTTCCTTGCGAATGTCGAACTCGGCCGTGGACAGGAAGTTAATCAGGGAGGGGAAAATGTCAGCCTCAATGATGAATTGGATCTGCTCCTG
GTTGCCGGCCGTGATGTTAGAGAGCGTCCAGCAGGCCTCCTTTCGGATGCCCTTCTTGGGGCTCTCCAGAAGCGCACGCAGGCACGGGAGCGCGTTCAGG
TTGATAATGACCTGCGTCTGCAGATCGTCGCCCGTCACGATGTTGCCTACCGTGCGCAGAGCAGGTGTCTGCACAGAAGGAGAGTGGTGCATTAGCAGCT
CCACAATTCGCCGGCACACACCAGCCTCGATCACTGCCTGAATCTTCTCGTTGGATCCATCAGACAGGTACGACAGAGCCCAGCAAGCGTCCGTCAGCAC
TTCCTCGTCGTGGGTGTAGATGAGCTGGCCCAGAGTCGGGAGTGCGGGCGCCACCAACTCGAACTGCGGCTGCGGCTTGCCACGACAGAAGTTGGACAGC
GTCCACGTGGCATTGCGGAGCATCGTCGGCTTGGAGTTCTCCGTAAGCTGCTGCATGAGCGGACGCAGGGCACCGCATCGCAGAACCATGTCACGGCACT
CGATCGAGTCACCAGCAATGTTACCGAGGGCCCACACCGCCTGCTCGCGCACATCGTCGTTGGTGGACAGCAGCAGCTGGCAGAAAATGGGCACGGCACC
GTGATTGATCACCACCTCGGTATCCGCAGAGGTGCCGGACGCAATGTTCGTCAGGGCCCAGGCAGCCTCGAACTGGAGCGTGGGGAAGTCCTCGCGCTGA
AGGAACTGCACGAAGATGGGCACGACGCCGGTGTCGATCACCTCCTTGATAGGCGGGTTGCGCTCTACAGCAACGCAAACACAAAATCAAAGTTAGTCGG
ATCTTCCCGGGCATCGCAGAATGCAGTATCATCTATTGCTCACCAATAGACAGCAGCTTGCGGAACTTGGTCACGGCCTCGAGCTGCACAGCGGCGTCGC
TCGACTGGACGCCCGTGACCATCTGAGGAAGCTCCGACAGCTGGAGTAGTACGCAGCACACAATGCAAACCCCACGAGTCAGTCCATGCCCTCTCAACGA
GAAAAGAATCCTGATTCTACGCTACTCACCCGCTGCAGCAGCGTCATCTCCCCGGCGGCGTCGCCCATGGCGGGAGCAGCCGCAGCGTTGTCGCCCGGCG
TCTACATCGGCAGCCAAACAAGAAGAAGAACAAAAGTGAGCCACCGTCCCCTCCCAACCGAAGAAACCACGCGTCTCCAGCCCTTCTAGACGCCTCCAGC
GGCCGCTACGAGGATGGATAGAAGGCTGTGGAACTCTTGCTGCTGCGTCTACACTGCTAAGGGATTGGGCGCCGGCCGTACCATGCGGCGGCGCTGGTTC
ATGCGGTCCTCCTTGATGGTCTTGCGGATCTGCACGGTGGTCTCCATGCGGCTGCGGCGCGACTCATCGGCATCGATGCCCTTCTTGAAGAAGTTCTTGC
GCTCCGGCGCCTTGCCTGCGGGGAACGACATACTGCTGGTCGGGGCTGCGGGGGCTGCTGCGGGCCGGCGGGATCGGCGGGGCGGCTGGATGCGGCTTCT
TTCCTTGTTTCCCCTCCTGGACCTCGCCGCCAATAAAAAAGCTGGGTGTGGTCCACACCGCGCAAAGAAAACGGACCCATACAATTACCGAGAGGTTTTA
CGGCCTGTGGAGAAAAACCTCGACCGACTTTCCCATGCACTCAAATGATTGCCGCATAAAGGCACGACCACGAAATCATATTCGGTGCAGTCATTTCAAC
ACTTACGTTCTTGAAGTCGCCAAAAGACGCGGGGCGGACCACGTGCGTGGCCAGTTCGTAGAGCAAGACGCTGCTGCGGGAGTTTTGTTACTGTCGGTAT
TGGAAGGCAGCGCGGCATCAACGCTGCCATTAGCCCCGCGATCTCAGAAGGCGATACGTGAGTTGAGCACTTTGAGAGCAGTGGGTATCGGGGCGTGGTC
GGTTAAAGCGTCTGAGAGTACGTGCAGACTCCTATAACTAGAGAAGCTGTTACAGCTGCAGTCTTCGGCACAATTATTCAAGTGATGAAGTCGAGCGGCA
AGTTGGCCGCGGCAGATGCGATGCCTTCATCGTCGTCGTCGCGCAGCGTGGTGATCCACGTCTTCGACGAGTACCGCAAGAGCAGCAAGGAGTTCACGTG
CCAGCGCGACCTGCTGCTGGCCAAGATGACGTACTTCCAGGCGTATCTGAACGAGGCCAACGAGCACGACGAGATCGACATTTCCGTGCACTGCGACGTG
GAGATCTTCGAGCTGCTGATGGAGTACATGCACCAGCGCCCCGACCACGAGTGGCGGCAACGCATCACGCTGGAGAACATCGCGTCGATCCTCGTGTCCT
CCGAGTTCCTGCAGATGGAGGAGCTGGTGGAGGAGTGCGTGGCCTTCATCTCGACGCGTGTGCAAGACTTCATGCTGCTGCGCGTGGACTTCGGCTGTCT
GTCGGACACCACCATCGCCAAGATCGCAGGCAACTGCACGCCCGAGCAGCTGCAGACGCTGCACGACCCCAAGGACAAAATCCTGTCCAAGCTGCGGCGG
AAAAAGGTTGAAGCGCTGGTGAAAACGCTACAGGAAGGCGGGCGGCGTCTTGAGCTATGCGCGAACTGCGAGCTGCTGTTCATCAAGGACGACCAAGAGA
GTGCAGGCTGCCAGAAGGGGAAGCGGCAGATCGGCGTGCACGGCGAGCTGGTCGGATGGCACCAAGCCAAGACTGGGTGGCAGGTTGAAACGTTCTTACG
AGAGCTTGGCGCTAACAAAGGCATCTCCTGGAGCGCGGCATACTGGTACATCTGGGGCTCCACCAAGTGCTTCCACTGCAGCGTTTGCAAGCAAAAGTGC
AGTTTACTCGAGCTACGAGACTGTGCCTACCATCCAGGCTCGATTGTCGATCACGGGCCCGCCGCCAAGTATTCCTGCTGCAGTGCGAGGATATTCAGCG
CCGATGAGATCTCCGTGCGAGGGTGCAAAACCACCGCCCACGTGCCACTTCAAGGTGACAAGAACGCCGAGGTGGACAGCTTCAGCAATGTGGTAGCAGC
CCCCAATATGTGGGAGCAAATCCGTGCGTGCGAGAAGATTGCAAGAGCACAAGGGCCTCCGTCGAGTGCGGATGCAGGTGGCGGCGGCCGGGTGGACGTG
GCCTCGCTGTTTCCTCCGCCCCAGACCAGGAAAAGTGGCGGCCCCGTAGTCGAGCGCGAGCCATCGTCCAGACGGCTGAACACAGCGGGTGACGGCAACT
CGTTGGGCTACCGGAAGCAATGCAGGGTGCTGCAGCTGCAGGAGAAGGATCGTGTTCGTTGCCAGGAGATCGCGCGGCAGCTCGTGCAGCAGCGCAAAAA
GGCAACTTCCTAACTCCGTGTACATGTACCACACATGTGGTACATCCGAGTGGATGGCAGTTGGTTGTTGACAACGTGCTGGGAGGATGTGGAAGCGGCC
GCTGCGCGACGTGGTGGTGCGCTGCCACGTGGGCAACCTGCGCGTGTCCGGCGTCATGGCGCGCAACGCGGTGGAGGAGGTGGCGCGGCGCTGGGAGCTG
CCGCTCGCGTCCGAAGGGACGAAGCTCTGGGGCGAATACATGGCCGGCACGGCCATGCTCGGCTCCTTTTTCAAGGGCGAGGAGCGCGTCAAGATGATGG
TCAAGACGCCCAACATCCAGGAGCTCTACGTGGAGGCCATGGCTGTCGGAGAGGTGCGTCGAGCACAGTCGCATTGTACGGTGCTGTGACTCAAGCCAGC
GGTCTCATCGGTGTGATACCTTTTGTCGCACAGGTCCGAGGCAAAGCTGTCTATGTGGACGAGTCTCTCGCTGGAGCACCAGAGCGTGGAGGACACATGC
ACATTTCCAAGATTTTGTATGGCGCCGCCAAGCCGTACAATACCTCCATCGAGGCGTCTGGGGTTCCTGAGCTGGACTGGCAGCGATTTTTCGACGTTTC
GGAGCAGGTCCCGACTATCGTGCGTATTGACAGCGCGGCGAACGAAGACCACACGCGCAGCTGTGGCCTTATCGTCCAGAAAATGCCCCCGACGGAGGCT
CATGAACGCCACTACGAAATTGAGGAATTGGCATTCGACAAGCTTCCGTTCTTCGCAACCGAGTTGAAGAAGAACGCGGACCTGCTGGAGTACCTGAACG
AGTTGATTCCTGGAGCTGACATCACGGATAAGAACTGCAAGCGGGTACCGCTGGATTACTACTGTCGCTGCTCCAAGGACAACTACGCACAGCGCCTCAA
GGATATGGGAGCGACTGACCTCAGGCAGATCGCAGCAGACGTCGGCAACGCCGGCGTGGACCTTACCTGCCATTTTTGTAACGATGCACACCACTTCTCT
GCTGACGAGCTAGAAGGTCTGATCGATTCGCTGTCCAAGGCATGATCGCTCGCACGTTAGCAACGAAGTAGTATATCAACACGGTTATAGACAGATGAAA
ATGACGGAATCATCTGCCTAACCGTTTATCTAGCCTTCTTGTCCGAACTCCTGGGTCCACTTCACGAAGCGGTTAAGCTCGTCAGAAGCAACCGTCGCGC
TCGAATGCTCCAGCACGCGTACAAAGTCACTCTGCAGGAAAATATCAGTTAGACGCTCGCCCAGTAAAACAAGCAGGGCAAACGAGCGACAAAGATCTTA
CCATTGAGATCATGGGTGGCCGGAGCTTTTCGTCAGAGTAGCCACGCTCCGGTAAATCGTATAGACGCATGCGCAGCGCCCCGCAACGCCGGCATGGAGC
CTTGCAGTCGGGACACTTAGGGCGGCATGTCGAGAGCTTCATGTGGCAGTAAGCGCATGGCGGGTCATCTTCACACGGTGTCAAGAACGGACCATTCCGT
ACGGGGTGTGCCTTATCATCGCACTGTATGGGAATTTCAATGTCAGAACAAAGCATGTCTTGCGATCTCTTACAACAATATCCTTACCGGAGTGAAGAAC
TGAGCTTGTTGACACTTTCGAAGAGGTTCCATTAGCGCGTCTCGGACAAGCACCGAAATATCTGAACCGGAAGAGCTATTGAAAAGCAACCACGGTCAGT
GCGTGCAACCAGCCCACAAGTGAAATCATTCGTACCCCTCCGTTTTTTCTGCGATTGCAGTGAAGTTTGCATCACTCAGCTCGTTCGGTGTATCGCCTAG
GTGAATTCCCAGCATCACCTTCCGCGCGTCAATGTCAGGGAGAGGAATGTAGATGCGTTTTTCAAATCTGTAGCAACAATTTCATGCGACTATCAGCATC
CCTTTCGTTCCTCGAAGTCATGCTAAAAGCGAGAAAAAAACCTACCGACGTCGCATTGCTGGGTCAAGCTCCCAGGGTACATTGGTAGCCCCAAGTACCA
GCACGCCATCGTGATTGTTCCCGATGCCTTGCATCTGCACGAGAAATTCGTTCTTGATGCGGCGCGTGGAGTCGCTTTCTCCCTCGGATCGACTCGAGCA
AAGCGAGTCGATTTCGTCTATGAAAATAATAGCGGGCTTCTTTTCGCGTGCCATCTCGAACAGGTTCTTCACCAATCTAGCAAACACGACATGCACAGTA
GATTAACAACTTCCCGTCTAGTCATATCAAACGTACCGATCTAACTAAACGTACTTTTCACTCTCTCCCTGCCACTTGGATACCAAACTGGAAGACGACA
CGGCGAAGAACGTTGCGTCCGCTTCTGTTGCAACGGCTTGTGCTAGGTAGGACTTACCCGTACCCGGAGGCTGCGCGCGAAATATCAACAACACGTCAGA
AAAAACACCTTTAGCGCCTAGTAGCATCTACGAAATCATACCCCGTATAGCAGGATGCCCTTCCATGGACGCCGCTTTCCCGTAAAGAGCTGCGGGAACC
TTGCAGGCAAGATCACGGCCTCTTTCAGTGCCTCCTTTGCAGCATCTAGCCCAGCAACGTCATCCCACTTAACATTGGGCTTCTCCGAGACGACCGCCGC
TGCGAAATATCCACAATATCAATTCGAAATCGCATGGGTTAGCCGCAGTAACACACAGGCCCCCGCAGTGCGCTACCTACAGGCCAAGGAGCCGCGTAGT
TTGGCAGTCTCCGCGTCCGTCTCGTCGTCGTCGTCCTTCTCACCCCTGCAAGCAGCCAGCATCACTCAGTACGTGCCTCACCCCACCCCTCGGTTAGTTG
CAGCAGCAGCGCTCACTTGTCCATGTCCACAGCAGCGGCCACTGCCTTGGGGGCGTTCTCCTTCTCCAGCATCCCGCGCAGCTGCTCGGCGCGCGTCATG
TAGCCCTCGACGCGCTTCATGATGATCTCCTTGGACGTCGGGTTCTTCTCGTCTGCAGGGGGCGGCAACAGCGTCAACACACACAGAACCAGCTCAGCGT
TTTGAACTTCCTGGCTCCAGCCCCAACTTCCAACGTACACTTGACGCCGACCATGAAGTGCTCCAACGCCTTCTTGTACAGGCGAAAGGCCTCCTGGTAG
TTCTTGCTGTTGTCCTCATTGATGGCCTGCGTCACGATCTCGATCGCCTGCGGGATGAACTTGTTCTCCATCGCGGCCGCCAGCTTCCTCTTGATGCACT
GCGGTAAGCTTCGGTCCGTGACCGTAAAGGAAAATCCATCGCGGCGTAACAGTTCTTTCATTGGTCGAAAATTGACTTTAGTTTCAACCTATCAAGGGGC
GCGACCATGTTGAAGTCGCCGATCAGTGCGCAATTATGGGCGTGGGCCAGTCGAAGGGGGGCGGCGGCGTGCGCTGGAAGCTGCAGCCGCTAGTGCCGCG
CTCGTGGGCAGAGCTGGAGCAGCTGCACCTGCGCTTCCAGCAGGAGGCGCACCGTCGCCGGGGCGACCCGTCCTTCCAGTACTTCCTGCCGTTCCCGGTC
TTCCAGACCATCGTGGCGCCTCTCTGCCCGGACAAGGACAAGCTGCAGCTGCTGGCCATGTTCGAGGCGCTAGATGTAAACGGCAGGCACAAGCTGGCGG
TCATGGACTTCTTCAGCGGCCTGGCGCTGCTGGTGGACGCCAAGAAGCCCCAGAAACTCGAGTGTGAGGAGGATCATGCCTGTTGCGGGGGAGGAATAGA
GTCTAACGCTACATGCTGCTGCTCTCTCGTTGCTGGCTGCAGTCGTGCTGTCTTTACTGGACAACGGAGGCCTCAAGACCCTGAACAAGTGCGAGCTGAC
GATGGTGGTGTCGGCGGCGTCCAGGGGGCTGAAGATGTTCGCTCCCGGGGCCGACGTCTTGCAGGAGTCCACAATGAGACCGCTGATTCGACGTACGGAA
CCAACGGGTTGCGTTGTTGCGTGTGTGTTCGGGTCTGACCGCGTATCCATGTTATGGTGGCACAGGCTTGTTTGGAGATAACGACGAGGTCCTACTGCAA
AACGTTGTCAATAAAGCTCTCGCCGATCCTGAAATCCTGTTCTTCATGAGTGATCTTGAGGCGGTAGGAGCTATTTGTATGCGGTGGAGAAGCCTTGATG
TCTCATGTGTTTGTGCTTTGCAGGGTGTAGCAACATCGTCCGATGAACTATTGATACAACAGGGAAAACTCATGCGGCATATGGCCTACCTGGACTACCA
GGCTGCCCGTGTAAAAACGACAGGTACAAATGCAGACTGAACTTGGATATTAGATTTACACCCAGCTGAGTTAAGCCTGGCATTTCTTGCTATGATGCAT
TATATCAGAAGAGAAAGGAAGAGTTTCAGCTGCAGTCCCTTTCAGTATTGGGCCCAACAAAGTTGCCGAGAGCCAACGAACACTAACATCCACATCGGCT
CCCACCGCTGAAAATTTTGCGCGCAGACTCCAGAGTATTGTGTGCCCGCCCCCTCCCAAGGGGCTAGGACAGTCGATGCGCGTGTTGTCAGCAGTTGAAG
TCAAGAAGTATGTGGACGCTCGCACCCTTCAGCGACTGGTTCGTGCTGTTTCAGATGGCGGGTTGTCACTTTCAACGATCGAGGTTCGTTTGCTCAGAAT
CACGTCCGAAGCTTCAGGAAAAGGACTAATGGTGGTGTTGACTATTGATTGTTTTTAGGCCGCAACACTCATAGGGGATATGGCAGTTGACCAAGTTGGA
CTTGTGCGGTGTGGTGATATCGTACGTGTCTTAAAAGCATGGGTGCAAAACCGGCGACGAGAAAAGCCTGAAGCGCTATGGGAAATCGTTGGTGATTACG
TTGTGGATGCAGTGAAAAGTATTGAGAGGAAAATGAATTCCATACTCTCTACGTTTGTTGGAAGGACGACGAAGACACTGGGGCCTGGCGCATGTCGGAG
AACTACCGTAGCTAAAGATCGTTTGGTGGAAAGTTTGCAAAATATTGCGCAAACTCCCGATAGTGACGATGGCGAGCTCCAGTGGAATATTACCGTTCAA
TTTGGTGCGTTAGATGTGCTAGAGGAAGCCCCAACGAGCTCTCCAATCACAGCGAAGGTGGGTGCACCACCGAATAACAATATCCGATTCCGAATTGGGG
TCCACCCACCAGGAAGTACGGATCGTGACGCAAGAACAAGGACTGATAAGGTCCAGTCAAAAAAGGAAAGTCAAGTTGATTATGATAGTGACGAGAGCCA
ACCAGAAGAAGTCGACGATGAATCCATGCGCCTGATCATCAATTTTTTGCTGAATCCGGAGATTACAGGTAATTACTGCTGCTGACTCTAATTTCAGTGC
AATCACTCTTAACATCATTGCTACCTGGTGGTGACAGATGAGGATGGTATTGACTTGGCGTCATCCATGGAAAAATCACTACAACAAGAGCAAGTGTGGC
CCTCATTTGCGTCATTTTGGACAAAATTCTCAGGTGCGTTGTCGTGAAGTAAAATGCTACGTTGGTGATCCTTTTAAACTCATCTAGCTGTGAATCTCTC
TGCTGCAGTAACCGTGCACTCTGCGGTTCGAAGTGTTGGAGGCATTCAACCCGTTCTTGGCAAGTATCTTCGCGTATGCATTAACTTTCGCGAAGACTTC
GTTTCAAATGTGGAGGTGGGTGGTCTGAATCGTTTTGAACTACTCATAAAGTCTTCTTTGAAAACTAAAGGATCTAACGACTTCGCTTCAACACACAGGA
ATGCACGGGCACATCTTTTGCGGCTGGGATTCGTAGCTTTTTCGTGTTGGGTGAACTCGATCGTTCGCTGATGGATATCGTCAAATCTTCTAAGGAAATG
GGGATGCTTCTCCACAACCTTGGAAAAAGGCATAATCGAGAATGCGCCATGAGAATGATTTTTGATGCGTTTGATGCAGATCACAGTGGCGCATGGAGTT
TGCAAGAATTTAATACGTTCCAGCAGGCACTCGGAAAGGAAGCTTTGCTAGAAGTCACAGTAGCTGAGATATTCGGGGGTACGTCGACGATTTCCTTCGA
ACAGTTCATTGATACGTACGCGAGTTATCCCGCTACAAAATTGCTCGAAATGATTCGCCAACTAGGAATCGGTAGGTCACGAAGTTGTATCTCTCAGATG
GAGAAGCATCGATACTGACATCGTCTTTTCGGCAGGATCGCTGGGTGATGTAGTCAAAGGATCCATTTCCATTACGTCAACGCTGAGCGAGCCCTGCATA
AAGCCTCTAGGCGCACTGCTGAGCTCGCTGCGCTGGGGAGACGCGGGTTGGAAGAAACTGTTATTTCTTACCAGGAGTACGAAGGACCTCAGCCTCGAGC
TCCAGTTTTCCAAGCTTGCAGAGCTTGCGCAAAAGTACTCCGACCATACCACGGAGCTAGGCTTCCTACTGGATCCATTGTTTGTGACCTCGTGGATAGA
GCGACTGGAGGAGTTCGTTCAGCCTATGCATACAGAGCACGCGAAAGATCGACCCTGCCGAAGTATTTTCTGTTCCCTGGAGCGCGAGGTTAACAAAACG
GAACAGCAACTGGAGTTCGATGATCAAAGCCGCAAGTTACCCCGTGGTACATCAGCTCGCCGTGCGAAGGGTATAGCTCCGTTTCTAGAAATGGCTAAAC
TGGTTAAAGCACACGTTCGTGGACCGGAGTTACTGGAAGTGCGCAGCAAAAGCGTTCGTATTGCGTGCGAGATCGATAATTTCTGCATCGCACCATCGAG
CGGTCCTAACCAGGATGACAACTCAGGAAGAGAAGAAAACATGGTGACATAGGTTAAATTTGGTGCATAAGAATAGGGAACCATTCCCGGCCACCTTGTG
GTGAATGCGAGTGAAATGATATAGAGACGGTGATTCAAAGGGATGAATCGCACGCATACTGCTGCAGCAGCCCCAAAGGAGGAAGCTGTATTGTCATTCT
CGAGCGATGAGTCGGAAGCTGAATTTGCTCAAGCGCTACAGGACCGGCATAATGGCTTGTATCAGGATGCAGCAGATGCACTGGAACGAATCATCGAGGT
ACAATGCAGATCCTACAAACTGCACTCTAACACGTCGTACTAATCCAATTTTGTGACAGCGAGAAGGCGACTCTGAAAGACTGTGGACTGAGCTAGCGCA
CACGCAATTCCAACAGTGGGAAGCTCACGTCAGGGTGCTGCATATGCCTTCCATCCTTGAGATTGCGTCGACATCAGAGTTGAAGCGACGTCGAGGCTCC
AACAGTGATGCCAAGCCAATTCATACTATACTCCTCCAGGAGGCTTATAGCACTTTCCTTATTGCGATGGAATACCCAAACAGCAAATCGAGTCCTGAGC
TGCTGCTTCAGCTGGCAAGACTGTACATCGAGTTTGGGTCGTATCGGGGAGCTCTTGCAGTATGCACACTGTTAGTGGAAGGGTATCCGACGTCCCTGCG
GCTCAATGAAGCAATCTTCTTGTCAGCACTTACAGCCTCAGCACTAGGGCGACATCGCGAAAGTGCTCAATACTTCCAATATTTAGCCGAAGGGCAGGGG
CCGTCATCGTCGCTTCCGTATCGTATCGCTGCCTACCAATTCAGTCTCCTAGCAGCGTTGGAGCTCGCGCATATACCAGGCATGCGTGCCTTGGAGCGTG
AGACGTACACCCAAGCTTACAAGGCACTGGTTGCTCTTCCACCGGTATTGCCGTCCGAGAAGACTGCGCACACCTTGTATACAACATCACGGAAGAATGA
GGAGCAGCGCACGCTGTTGTGGTGCCGTGACTTGCAGACATGGCTGGATCTTGCCCAGCGACTCGCAGGACCAGCCAACGCACCCCATCTCGTAATTTTG
GCGCTTCGAGAAGCTCGCCGCAGGATGATGGCAGCTTCAGGGGGGATTCCTGCTCCAAAACTGCTCCTGGAAGGTGCTAGTCTATTGCGAACTGGAGATA
ACTTGGCCGCTGAGAAAGTATTTACCGAAGCACTTTTGTTGGTACCTCGTGATGTGTACTATAGTGCCCGTCATGAACGATTCTTGCTGGATATATGCAG
TCCGTCGTGGCGTTCACAGTTTGCCTTAGAGCATACGAGTGCTGCACGTTTACAAGCGTTTCATCGGCGATGCAGAAGGTTGGATCAGTGGCGCAGTGGT
GTAGCTTATGTTCTAGAGCAACACCATCATTCCATGACACTTCGAATTCAATGCGCATGGCGAGGATTTCAAGCACGAAAAGAGCTTTCAATCTTGCGCG
AAAAACAGCGTGAGAGGGAAGCTCAAGCTAACGCGGCCTTGGGTAAACAGGACGACAGGCTTATCCAGCGGCGTTTGGATGCTGCAGCGAGAAAGATCCA
ATCATTGCTTCACATCGCACGAGCTAAGCGCGCACTGCGTGCTCTTCGAGCACGGAAAATCGAGCGTGAGACTCTACTAGCAAAATTTGTTGGTCGTCGC
ACAGAACTCGGACAACTTGGAGTCTTCCGCAGATGGCGGAGTTTTGTTTGCAGCCAAAAGCAGGAACGCCTCGATGCTGCTGTACAGATCCAGCGGCAGG
TTCGCGCCTGGCGTAGCCGCAAACTCTGCTTTCAATTGATGCTATTGCGTCAGCAACAAAATAGTATCCTACAACAGTGCCTGGCAAAACGCTCGACATC
CCTGGTTTTACGTGTGTTTCAAGCCTGGAATATCGAGCTCATTAGAGCTCGTAGTGAACGCGACCAGGCTTCGCGACTTATTCAACGTAGATTCCGCTCA
CGGTTAGCAGTGCGCCAATATCGTGCAGAACTTCGTCGCCACCGGGCTGCAACCAGCATAATGAATCGCTTGCTCTCAGATCGCAGGCACCAAAAGTTGT
TAAACACTTGGCGGGCGCTTGCAAACCACGCGCTCGTGCGTCGTCTGCGCAAACGCGGTGCGGCTACAACCATCCAAAAGCACGTACGTGGTGCACTTGC
CCGACGGCAAGCTAAGCGGCTTCGTACACGTCGCCGACGTGCTCTCAACATTCTAGGAAAACTTACTCGTTCACGCAAAGCTCAGCTCTTGCAAACAGGA
TTTGACCTACTTTGTCGGCACGTTCAGGAGTACCATCGAACAAGAAATGAGGCCGTGATACTCATACAGGGACTTTTCCGGGGCTTTCGTTGTCGTCAAA
GACTGCATCGACGACGAACCGCAGAAAAGCTGGTAAATGGGAAAGTCACATTTGGTAATGGGCTCAAAGGCCAGTCGCCGGACATTGTGCTGTGGTCGTG
CCTATTAGCACTTTCACGATATGTTTGCCAGCGTGATGCCGCAGTCATTCAGTTGCAACTTTGGTGGAGACATCGGACAAAACGTTCTCGAATGCTTCGA
GCGCTTAGTAAACGAGCAGCCCAGCGTCAACTCCTGGGCACACTTCAGCAAAGTTTTTACACCCTTGCCAGGAGTTTCTTTCGGGAGCTTCGTACTGCAT
GCAACGCCAAAAAGGCTCGACAACATACTGCAGCAACCAAAATTCAACGTCGTCTACGTTACTGGCTGATGCGTCGTAGATACCTCAGCAATCTTGACCG
GTACTCTGTTGCTGCCCAACGCGGTGAAAAGGCAGCGAGAAAGATAGTGCTACAAAGAGTACGTCGATTGTTTCATGGTTGGCGAGATTTGTCTATAGAG
GCACGGCGAATGCAGCATGAGGCAGCTTGCTTGGTGCAGCACACCTTCCGACGCCATCGGGCTCAGCGCCAAGCACGCGGCATCATTGCCAAAAAGGCAG
CGCAGGCGAGACTTTTGGCCGCAGCCTCTCAAAAACCACTTGAATGCTGTTTCCGTCAATGGGAGACAGTAGCCCTGCTCGAAAAGAGCGTGCTACGTGT
GCGTAGTTCATCACTAATGGGATCAAGGGAGACCACGCCTGTCAGCGGCAAACGTAAAATCGGTACCTCTTCTAGTGGCAAGTTTGGCAAAGCCCTCACG
CTCGAGGAGGTAAGCTGGTGGGATGCATCTTGCCGGCGCGTAGCAGCGTTCACTAACCCACCGATGTGTTGATGTCAGCGCGCCGAAATACCGTCGATGC
TTTTCTACACAATGCTAAACCGTGTTCGCCAGACTGGGGTGTGTCAGCTTTCGTACAGGTAAGCAACATCAACTGCAGCATACTCTACCGGAAGTTTGGC
CCACTCATTTCTGAACACTTCCTCGCATCCAGTGGCGGCACGGTGTTCAAGGGCGCCCAGCTCCGGCAATTAATCTCACTCGCTACGAGCATAATTGCCG
ACGGCGGTGGTGGCCTCCAAAGCGCCAATCCAGCTCCAAGAATCTCTCCTCTCAACCTCAACGAGCAGATCGTGGAGGCCCTTGACGTCTGCTCGAGCTG
TACCACCAGCTCGTGTCCCGTGCAGTCGCTCATTCTGTGCAACGCGCCCCTGCGTCCTTCATCCGCGTCCGTCCTCGCCGCGATCCTGCAGCGCAGTCGC
CGCAGCTCGAGCCTCGCGCTCGTGTCCGTGGTGCTGGCCAACGTGCCGCTGGCGTCTGCGTCCGTCGTGTCAGTGGCCTGCGCCTTGGCTCAGAGCCCGA
GCTGTCTGCAGCAGCTGGTGCTGGAGCGCTGCGCAGTGGGCAGCGCCGGCGCGGCCGCCATCTTCGAGGCACTGGCGCACAACCGCGCGCTCTGGAAGCT
GGACCTCAGCGGCAACCACATCGCGGACGCCGCCTGCCCGGCTCTGGCGCACGCGCTGCTGGCTGGCGGCGCCTTGCGCGTGTTGGCGCTGAGCCGCAAC
GCGCTGTCGGACCGCGGTGTGCTGGGCTACGTCGCTCCGGCGCTGGCCTCGTCGCAGCTGGAGACGCTCGCGCTGCTGCAGAACCCGCGCGTGTCGTCCA
TGGGCGTCGCGGCGCTGCGCCAAGCGGCGGAGGCGGCGAGCGCAAGTGCGTCGTCCTCTGGGCCCCAGGATCAATTAGGGCTGCGAGTCCTTTCGGATTG
AGCGCCCGCGATTGGCCGACCAGATGGCTACATGTAGCCATGTGAGGCCTGCGCGCGCGCTGATTGGCCAGATTGGCTGGCTGGTGGAGCACCCTCGGTA
CGTCAGTGTGTCCGCTTGACCTGCTGCTTGGCTGGCTCAGAATTGAACACGCCGACTTCCGCATCACCATGGCCGACGCTTCCCCCGTGACCAACCGCAA
GCAGGTGGCCATCCTGGACTTCGGCTCGCAGTACAGCCACCTGATTGCGCGCCGTGTGCGCGAGCTGCACGTGTTCTGCGAGCTCTACTCGTGCCTGGTG
AGCGCCGAGGAGCTGCGCCAGCACCAGCTCACGGGCATCATCCTGTCGGGCGGCCCGCAGTCCGTGTTCGATGAGGGTGCTCCCCACGTGGCGCCCGAGG
TGTGGCAGCTTATCGAGGAACAGAAGCTGCCCGTGCTCGGCATCTGCTACGGCCTGCAGGAGCTGGCCTTCACCAACAATGGCAAGGTGGCGCCCTCGCA
GCACCGCGAGTACGGCAAGGCCATCGTCACGCGCAAGAGCGGCGTCGACTGCGGCGGCCTGTTCGAGGGCCTGCCCGACGAGTTCCAGATGTGGATGAGC
CACGGCGACAAGCTGCACGCCCGCCCGGACGGCTTCGTGGACATCGCCACGACCGAAAACTCGGAGCACGCCGCCATTGTCAACGTGGCGCGCAAGTTCT
ACGGCATCCAGTTCCACCCGGAGGTGACCCACAGCCCGCGCGGCAAGGACATCCTGCGCAACTTCGTGGTCAACATCTGTAAGTCTCCCACCGACTGGGA
CATGCGCAGCATCGCCGACGCCTTCATCGAGGAGGTGCGCGAGACCGTCGGCCCCGAGGGCCACGTCATCGGCGCTGTGAGCGGCGGTGTCGACTCGTCC
GTGGCCGCTGTGCTGCTGCAGCGCGCTCTGGGCGACCGCTTCCACGCCGTGCTCATCGACAATGGCCTGCTGCGCAAGGACGAGGCCACGGAGGTCGTCG
ACCGCCTGCAGACGAAGCTGGGCATTAACCTCAAGTGCATTAACGCTTCGGACCGCTTCCTGGCTGCGCTCAAGGGCGTCACCGAGCCGGAGACCAAGCG
CAAGACGATCGGCAACCTGTTTATTGAGCTGTTCCAGGAGGAGGCCGAGCGCATCGGCCACCCCGTGGACTTCCTGCTCCAGGGCACGCTGTACCCGGAC
GTGATTGAGAGCATCTCGTACAAGGGTCCCTCGGCCACGATCAAGACCCACCACAACGTCGGTGGCCTGCCGGAGAAGATGCACCTGAAGCTCATCGAGC
CTCTGCGTGAGCTGTTCAAGGACGAGGTCCGTGAGCTTGGCATGGCTCTGGGCATTGACGAGCCCAGCGTGTGGCGCCACCCGTTCCCCGGTCCGGGCCT
CGCCATCCGTGTGCTCGGTGAGATCACCCCTGAGGCGCTGGAGACTCTGCGCCACGCCGACTCGATCTTCATTGAGGAGCTGCGCAACAGCGGCCACTAC
AAGACCACGGGCCAGGCCTTCTGCGTCCTGCTGCCCGTCAAGTCTGTGGGTGTCATGGGTGACGGCCGCACGTACGAGAAGGTTATCGCTATCCGCGCCG
TCAGCACGTCGGACTACATGACGGCCGACTGGTACCACATGCCGTACGAGGTGCTCGGCCGCATGTCCAACCGCATCATCAACGAGGTGCGCGGCGTGAA
CCGCGTCGTGTACGACATTTCGTCCAAGCCGCCTGCCACCATCGAATGGGAGTAAGCGGTCAGGTGATGCCCTCGCTTTGCCGTCACCTTTGCAACACAG
CAATGCAAGGTCGCTAGGATAGGCACGGCCGAAGGCATCACTTTACAGTAACGTCAAGCTAATAGAGCAACGATACATGCATGTACACTAAAACACGGTC
GAATGAACCAAACACGGCAGGCACGCTGTCCGATTTTTTTTTCAGCATTGCGGTCCTTGGATCACTGCGACAAGAATTCTTAGCTTCAGCTTGCTGTAAC
GGCTGCTGAGGACTTCATCACTGGCTTTGCTCGTTGAAAAGACCGCTGCAGAATGCCCGACATTCCCGCGTACGAAACACTGACAGTGCTTGGCAGCGGC
CAATTCGGCAGCGTGCTCCTCGTTCGGCGGAATTCGGATCGGAAGCTCTTTGCGGCTAAAGTTCCTCACGGGGAGGATGCCGCCACGAAGCGGGCATGCC
GGCAGGAGGCCGAACTACTCATGCAGCTGCGCCATGTGAACATTGTGCAATTCGTCGAGCTCGTTGAAGACGACACCCAGTTGGCACTTATCATGGAGTA
CGCTAGCGGCGGAGACCTGGATGCGTTCTTGCAGTGGCAACAAGAAAGCACGTAAGCTCGCTCCAACTTTCACTACTTGCTCTTTCGTTATCTGACAATT
TGGTTTCCGCAGCGGACATCTCAGCGAGACTGCAATCATGCGCATTTTCATCCAGGTCGTTCTAGCGCTTCAGTACTTGCACAGGCACCACATTCTCCAC
CGGTACGCCAGCAGAACTTGATCTTTTGAAGAGTTCGCTCACTCTCGAGTATTGTGATGGTAATGCAGAGATCTCAAACCGAAGGTTTGGGTCGCTGCAT
TCGGTCTTAATTAACCCCGAATATGCGTGCAGGACTACCAGAGTGCTCACTGATTCGTATTCTTAAAATTCACTCAGAACATCCTTCTCGACGGTGACGC
GGTCGTGAAGCTGAGCGACTTTGGTGTCTCAAAGATTGTGCACAGCTCGCTTGATTCTGCCCAAACCATCACTGGAACACCGCACTACATGTAAGCTGCA
TCCTAACAACCACATTCCTTCAATGGTTTGCTCATATATGCGTGGCGGTTTAGGTCCCCTGAGATCCTGGAAGGTGGAGCATACGACTGCAAAAGTGATG
TTTGGAGCCTTGGTTGCGTGCTTTACGAGCTCGCCACCTTTTCTCCGCCGTTCACCGGTTTGGCCCTGGGTTCAGTTGTCGGTAAGATTTTGCACACTGA
GCCTCCTTCAGTCTCCCACCGATACTCTCCATCATTCCGAGCTCTTATGGCCAATCTACTCGACAAAACCCCCAGCGTGCGCATGTGTCGCTTGATTTGC
AAGAATTGAAATTCATAACTCCTAATTATTTGCTTATGTGGCATGAATCCTCACAGAAACGACCAGGCTTGAGCGATATTCTAAGTTGTGAAGCAGTCCA
GAACCACATGACCCAGCTAGTTAGTGTGGCAACATCACACCAGCCCATGATTCTCGAACAGTTCGCTGCGCGAAACAGTGGCCTCGAGAACTCCCCTCCT
CTCGAGTGCGTGTCTCCACTGCCGCATTCAAACTATATTCACAGCGTCGGCGATCAAGCAGTGCCCTTGGACCCGCCCCCGATTTCAAGTTCACCAGCAA
TGCAAACGCATTCGGAAGTGGGCAGCGCTCGGCAGCTTTTCTTCGAAAACCAGGTTCGATTCATTTCCACCAATTTGAATCACCACACAGGTCTGCTAAT
AGCGTGAACCTCCCACCTCTCAGGCTGCCGCGCGCAAGAACAAAGAGCGCATTGATCGAGAGAGGTCACGAGGGGCTGTTTTCCTGGACTGCGATGGTAC
CGCATTGCCCGATGCTATCTGCAATTCTGACCAAAAACGAGAAAATGTGCGAATTGCGAGCCCAAGCCTTGAACAAGTTTATGAACTTCCAGCCGTATCG
CCAGCTGCTAACAAGCTCGAGTCGCCCCCGGCTCCTTGCCCAGTACCTTCGTCCGGACCTCGAGCCCAGTCATCACCGTATGTAACTCGGGTTAGCTTCA
TAATAAATATTGTAGCGGTGGCTAACAAGCGCCTGTGGTGCATCCTTAGGAGCAATTACGAGGAGTTGCTGAATGTCGAGCGTCGGCGCATTCAGTTCGA
GACCAAGGCGCTGCAGGAACGGATGCGAGCAATGCAGACCGCAGATTGAGTCCACTTCAACATGGATCCGGTCACTATTCCCCCGATATAGTGACATTTG
CGCATTGCACACGTCCGACAGCACTCGCCCTCCTCGGATCAACCATGAAGGCCAAGCAGTTCGTCGAGTTCGGGTGCGCCCCAGCCACTGGCGACAGGAC
GTCCATAATATATTACCCTTCCTTATCACGTTCGTGTTCCCCTGCCGAATAGCAAGAAGATCGTGGCCATCGGGAAGAACTACGAGGCCCACGCGCGCGA
AATGGGCGCCGCCTCGGCCCCCAAGGACCCCGTTCTCTTCCTCAAGCCCACCACTAGGTCGGCAGCAATTTCACTTCTAACTGCCCTTGACTCTGAGATG
AAACATACTGAAGTTCGTGTACCGTGTGGTGACGACGACTCTGCAGCTACGTGCGCAACGGCGGCAGTGTCTTGCTGCCCCCCGGAATCGGCGAGGTGCA
CCACGAAGTGGAGCTTGGCGTAAGTTCCCAATCAAATAGCGTTCTCTTGCGTAACTTGAGCTAAAGTGGTGTTTATCTTCTTGCAGGTGGTGATTGGCAA
GGGCGGCAAGGATATCGCTGAGCGTGACAGCATGGACCACGTTGCTGGCTACGTATGCGGTGACAGTTGTGAGAGTCCCACCACGATTACCTTCCCTGAC
GATGGACACGTTTCTATTATTGCCAGGCACTGGCGATCGATATGACGGCGCGTGACCTGCAGGCGAAGGCCAAGAAGGCGGGACTGCCGTGGACGCACGC
TAAGGGCCTCGACACTTTCACGCCCATCAGCGACTTCATCCCCAAGTCGGCTGTGCCGTCGCCTCACGACCTGAACCTCTGGCTCAAGGTGGACGATGAA
CTGCGTCAGAACGGCAACACTGGTGACATGGTGCACAACATCCCGTTTCTGATCTCTTACGTGAGCCGCATCATGACGCTGGAGGAAGGAGATTTGTTGA
TCACCGGCACGCCGGAAGGAGTGGGTCCTGTCCCGACTAACAGCGTACGTGTATCTGCTCGTGGGTCATATTTGTGCATCATCTTACTTCAGTGGTTATG
CCCCTCCCCCTGTAGGTGATCACTGCAGGTATTACCGGGCTGATCGACGTGCGCTTCCCAGTTGAAACGCGTGTGTACAAGGCTTAGATGTCCGCCCGGG
CATCTTGTATTAACTTTTGCCGAATAATTGCGCCAAGCAATACTGCAATCAACGATTTGCGGACATTTCCGACTTGGTGCGATACTTGGCTGCTTCTAAC
GTTGTTTTGTGGCTGTTGCCGCCTCGACCAGCATGGAGATTTTGCGGAAGTTCTGCCGACGTTTAGAACCAGAAAAGGTCGAACGGACGTGCCAACCCCG
ATAGATTGCCTGAATACGCAGCGCGGCAGCGTCATGACGCAAGTTACGAACTGCTGACTGGGCGTAGGACCGCACCTCATGTCGATTTGATGGTGCTCTA
ATCAGCCGCATGAGAGCTCCCAGCACCCCGCTTTCTACCAGTCTTGAGCGAGCCACGTGCAGTTCCGATACAGCGGCCAGTGCACGCGTAGCCTCGGTAA
GTAAAGCTTCACCTAGACGCTTGTCGCTGCTGTGCCCAACTGCGCGGCCTCGATTCACCGGGCTTACGTACCTTACAAGTACAGGTAGCAGTCCAGCGTC
GACCAGCTTCAGTACATTTTCCGGACGCTCGGCGAAATTGGCGATGATCTGAGCTACATGAAGTCTTGTAGAGGCAAGTGGGTGAAAAGCGAACTGCCCC
AATGCCGACAGAAGTGCAGGCTTGCACAACGTTAGACGGGAAGGTGCATCGTGCGTGAGTTGTGCAAGTGCTCCCAACGCGTCCACTTTCATGCCGAAGT
CATTTCCAGCCAAGATTCCAAACAAGCACTTGACAACTCCGCGCGCAAGAAGCTCAATGTAGTGCTGGTAGTCGCGCTCTGAAGTTTGGTTTGATCCGCG
AGGAGAATCATGCGCACTTGGAGGTACGTCGTCTTCTGTCCCTGCAAACTGCTTGGATTCTTTGCGTCGTTTCCGTTCGGTGCAAATCAACAGCGTAAGT
AGCGTGATAACTCCACGCCGAACGCGCTTGTCGGATGAAGCGTATAGCTCGCGTGCCGCCATGTGATCCAGTACCTTCGATCGAATCACGTGCTCTCGGT
TGGCGGTGTTGCGCGTCATTGCGCAGAAGATCCCAAGCGCCGCGCGGATAATCGCTGTAGCTTCGGAAGCTGGCCAAATGGAAGATGAGCGCGAGCGAGA
ACGCGATGATGTGGCAGATCCAGGACGCGAAGCGGGCGCCTTAGTCCGGGTAGGTGCTGTTACCGCAGTGTGTGGGCGTTTGCTATCATGATCAGGTGTT
GGGAACCCGCCGCTGGTAGAGAAGCACAGATGAACAAGCCGTGTCATCGCTTCAGCTTGCACGAGTGCTTCGTGATTAACTTCATCCTTCGCGACAGCAT
CAAGAATCGCTACCACCAGCAAGCTCACTTGAAGGGATGGCCTCGTTGCGCAGGATGATCCGCGGCCAAGAACGCTGAGAACGCAGGGCAAAAGCCCAAG
CGATGCGAATCGACGAGCATTCTCCGCCTCAGATAAGAGCAAATGGATGAAGCTCAGCAACTCACGGCGGAAGATTGCATCTTTGTCGAGGAAAGGATCC
CGCAGCAGCCCAGAGAGCGTTGTGAAGTGGCCAGAGTAATAGAAGAGCACTCTGTTGTCGCACGAAGCCGCGAGCTGATGAAGCACAGAGGCCGCCAGCG
TTCGCGTTCGTGTATTGCCAGCCACAGCACCTCGTGTACTTTGCGGCGCATCACTTCCAGAGCAGCAGTTCAACATGAAGGCGAAACCTTCACGCTTGGC
CACTGCTTCGCGCCACTCATCGGTCGTCACTAGGCGTGCGACGACCTCGAAGCCAGCAAGGCGGAGTTTTTGATCTGTTGTAGTGTGCAGCAGGGAGAAG
ACGCAGTCGATACCTCCAGGTGCCTGGAGAAGCTTCGTCTTGATAGTGGATAGCCGGACAAGTGCAGCAAGCGCCTGCGCACAGTCATGCGAGATCCCCG
AGTCCTCGCGATCCACTGGTGAACTTAGCATGGTCAGAATTGCGCCAAGTGTGCCAACTTCGTCAAGAAGCTCCAAGTTTGCGGCTACAGTGCATGCAAC
GGAGTGAAAGAAGACGAGATGTCAGAGAGCTACCATCGCTAGGTGACCAGATAACACGTACTGTTGCGACTCAGAGACGCTATTGCAGCTGCGGCGTCGC
GCCGGACCTCCACGAAGGGTGACCAGTAGATTATCTCGATCAGCGGACTGACATCATCGGCCTCAACATCTTGCCGCCGCAGGCTTTTGAGGACTTGAGC
GCTATGAAGCGAGTCTCGACGACGCTCAGTCTGCATTGCATGCAACTCCGCCTCGCGTGCCAGAAGCTGTTGCCTCTTCGGATCAGCTCGAAGCGAAACA
GTGGTGACAGGCGTTCTACCGACTTTCTCGGCTGCGTCCATGGCATCGGCTTTGGCGGCATGTTGGTGTCCGTCACTGGCGCGACGAAGCGGCATTGGCT
GCGAGAGCCTTCGGCCTGTTGGAGGGCTGGCCATGACCCCCTGCCGCTGCTGTTCTTTCGCTGCTACCTTGGCTCCAGGGCTCGGCTTCCTGCTGCTATT
CGGCTGGGCGTCCGTCGAGCTGTCTTTGCGTCCTGATGCAGTGGCTGGGGCGGCTGCAGCTGTGGTGATGGCGGCTCGGAACTGCTCCCGAGGATCCTGT
CGCGGCGTTGCCACATCTGGTAGGTGCTTGTCAGCAGCAGCCATGGCCGGACGCTCCGTCCGCTTCGATGCCGTCCGCGGCGTCGCAGCAGCAGGGAAGA
GGTCTGCAGGTGGCTCGTTCCATCGCCGCTTGGCGACTGCGCTccccggctgggcggccggcggcgcccgcggcTTGGAGGTCAGAGCGGGCGGCGGCTT
GAGGCTGGTGGCCAGCGGCATGGCGCAATGGCACGGCGCTGGATGGAGCCTGGGGCTCGCCTATAATTAATTATACGTGCAAGTTGCAGTGGTTGAAGTT
GTTTCGGTGGTCGAACAGTAGACAATTCCAAACATATTCCAAATATACAATCCTATTTCGTTTTCTGATACTTGTATGAACTAGATTTAGAACAGTTGTG
ATTTTGCCGAATCGAGCGACGAGGAAGCCGCAGTCGCCGCCGCCATGAAGAAGAAAGTGCGTGGGCCCACGGCTGCCTTGGCTCGATGAGGCCCCTCTGC
TTCTTCCACTAATGGCCGAGGACATGTGCTGTGCGCAGGTTCTGCTGATGGGCAAGTCCGGCTCGGGCAAGACGTCCATGCGCTCCATCATCTTCGCCAA
CTACCTGGGTACGGGGAGGCCGCTGCTGCCTCCCAGAGATGCAATCGCGGCAACTCACTGACGTCCCCGCTACGCCTCTGTTGTGGAATGGCAGCACGCG
ATACGATGCGACTGGGACCCACGCGTACGTGGCTTGGGGTGTGGACACCCTGACGAGAGGAGATCCAATTAGAGGTTTTAACGGAGCTTTTATCTTCTGG
CGGCTGCTGTTGATGCTGCTGCTGGACTGCAGTGGACGTGGAGCACTCGCACGTACGCTTCCTGGGCAACTTAGTGCTGAATCTGTGGGATTGCGGCGGG
TACGACGGCGGGAGGGTACTGTGTGATGAAGTTATGGTTGCTGACTCTGACGCTTCTCGTCGTGATGGTGGGCGTTGCAGTCAGGACGCCTTCTACGAGA
ACTACTTCGAGAGCCAGCGGGACCATATTTTCCGCAGCGTGGAGCTGCTGATCTACGTGTTCGACATCGAGAGCCGCGAAATCGACGTATGGGATTCTGA
TGCTTTAGCGGGGCATGTTGCAGTACCTCGAGCTGACCCCTTGCGTTGGTTGCACGGATTTCTCCCATTTGTAGAAAGACATGGCTCACTTTGACGGCTG
CCTGGAGGCCATTGACCAGAACTCGAGCAACGCCAAGGTGTTCGTGCTGATCCACAAGATGGATCTTGTCCCCGAGGACCAGCGTGAGCGCGTACGTTGT
GACTGCAGACTATGAGGCGGAGCATGCGCTGATGTGCTGATGTTGGATTGTTCGTGGTGTGCAGGTGTTCAACCAAAAGAAGGAGATGATTCTGGCGCGC
ACGGGCCAGCTCCCTACGGTGTGCTTCGGGACGTCTATCTGGGACGAAACGCTGTACCGGGCGTGGTCCTCCATTGTGTACTCGTTGATCCCGAACATGC
AGGACCTGGAGAAGCACCTGAACAGCTTCTGCTCCATCTGCAGCGCTGACGAGGTGGTGTTGTTTGAGCGTGCGACGTTCCTCGTGATCTCGCACGCCAC
GCACACGAACCACCGCGATATTCACCGCTTCGAAAAGATCAGCAACATTATCAAGCAGTTCAAGCTAAGCTGCAGTAAAACCCAGGCGCAGTTCCAGGGC
ATGGAGGTGCGCAATTCCAACTTCACGGCTTTCATCGACTTCTTCACCGCAAACACGTATATCATGGTCATTATGTCCGACGACTCGATCCGTAAGTACT
TGCGTACGTCTCCGTATATGCAGCCATTTTACTAACTTTTCATCCTTCTGTGTGACTTGCCTGAGCAGAGCCAGCGACGATCCACCTGAACATTAAGGCG
GCTCGCCCGGTGTTTGAGGAGCATGTGCAGCAGACGAGCTAAGCTGCAGATACATGCTACTGTGGCGTGGTATTTGCAGTTAAGATCAAGTGCCCAAGGG
CATTGCAGCAGGGAGGTGCTCCATGGTAGAAGATGTCTTGCAAAAAGACAAGAGTGCCAGCTAACTGACTGATGCTAAATCTAATGGACGAGCAGCTTCT
AGTCGATTCAAAGCTTTACTTCCATATACGTGCCAAGAGACCATCTTGCAGTCTCTGCAGCGTTCGTTCGTTGAGGACGAAATACATTCAATCAAGCTAC
TGAGAAGGTGGCGGTGGTGGTGGACTGGAGGCCGAGTTGGTCGAAGCCAGCATGTATCCTCTGCGCCGCAGCGCCCGTAGCACCACCGGTGTGACGGCAA
ACGTCAGTGGCCACCTGACAGGGGCCAGCACCTTGTACAGCGTGTAGGCGATGAGCAGGGATCCGGCCGAGTTGGTGGTCGAGTCGCTCACTTTCGAGGA
CAAGCCCACCGAGTCCAGAATAGCAGTTACGTCCACCCCGCTCGAGACGCCCACGTAGATGACGGAGAACGACAGTAGCGATAGCACAATGTGCGTGCAG
ATGCCCACGCGACCGTACTCAATGGCGAACGTCTTAGCTCGCTGGCGCCACGACTGCGGCTGCAGCTCTTGTCCAGGCTGCTCCAGCTCCTTCTCGGCCT
CATTCCCGCCCTGTGGCAGCGCACAAATACATCGTCAGCGCCTGTAGCTCCAGTGACACTGTGGGGATAGGAACAAAAGAAAGTGCGCACCTTGACGGGC
GTCGAGGCGGAGGAAGAAGAAAAGGAGGAGGACGCCGTGTCTCCTCCGGTGAGCGGCGACGTCTCCTGCGAGTCCTTGGACGCTCTGCCACTGGACCAGA
GGCGCACCATGCCACAGTTAGAGCCGCACACGACAGCGATCGACGGCGGGAAGCCCGACAGGCGGCGCGACGCAGCGGCGGCGGCTCCAGCAGGTCGCGG
GGCTTGGGGCCAGGACGAGGACGAGGAAGAGACGCCGCCGCTCCAGACGCCGGAGCTCAGCGAGCGCGCGTTTCTGCCGGAGCTAACGCCGCGCTTCGCC
GCACTTCGATACACGCACAAGTACCTCACTCCGCCGCGCAGCATCATGGAGAGACGAAGAAGCGGAGAGCTTCGGAAATGCAAGACTTGCTCATGCGCGT
CGAAATCCAAGATGTGGCGCACACCAAACGCGGCAGATCGAGTCGGACACGGAACTTCAACGCGTGTCCCACACGCTTGGTCGTCACTTGAAGAGCTTCC
CGACGGCGGACAGACGATGGCTCTGGTGCGCGGCCTCTGGGCGGCGCGCGGAGCGCTACGGCGCCACACGAGCAGCTCTCTGACTGCCCAGGCGCCTCCC
CGACTAGCGCTGCAAGGCCAGCGCCAGTGTCCGCGCGCGCTGTTCGCCACGAGCAGCGACGGCAAGTCGGCGGTGGCCCACCAGCGCCAGCAGTCCTCGT
TCCTGCGCAGCGTCGACCTCAGCAGCCCCGCGGCGCAGCGCAAACTGTCCAAGCTGATCCAGGAGGTGGTCAAGACCAAGGCCAACACGGGCGGTGCGTC
TGTAGGGAGCAGGCAGGAGGCTGGAGCTTCAATTAATGGCTGTTTGGGGCAGACTTCGTGCCGCAGGTGGTGATCCAGAGCCTCTGCACGACGTACCGGG
GCATGGACATCGACGAGAAGAAGCAGTTCCTGCTCATCTTGGCGCAGGACCTGCACATCGACCCGGCAGTGGTGAGCACAGAGCTTCGTTGGCTACTGGA
CCAGTGCTAATGTTGCTGTTGCCTCGTGTGGCTCACTGTTTTCTTACTGTATTTCTGATGCCGAGCAGGCCCTGCAGAGTGCCGCTCAGTTCGAGCAGAA
CCTAGCCAACGTGCAGGACGCCCGTAGTGGCTTGGTTAATTGGGACCACGAGAATGTGGAGAGGTTCCTGCGCACATTCCGCAATCTGCGGAACGCGCTC
TCGCCGCTGTATGAGGTGAGGGGGATAAGGGAGCATGGACTCGTTCTCGCCGAAGGTGGCTGGCTAACCTTGGGGTGGTTGCAATTGTTGGTAGACCTTC
TTCCAGCAGATATTGTCGCAACGAGAAAACGGGATGCTGTTCTTAGTGCATTTGCGGGCGGACCTGCTGCAAGTTCTGCGCAAGAATGCCACGCATTCCG
AGATACCTGCGCTTCGCTCTCTTGATGCAAGCTTGAAAGTGAGTCTTCCACGTCTTGGGCATTGACACGTTTGTTTTACTTATTACCTGTACCTGTTGAC
TAGCAATTTCTGGCTTCGTGGTTTAGCGTTGGTTTCCTGAAGTTGGAGCGCGTGACATACGAGCGCTCTCCTGGTCAACTACTGGAGAAAATCATCCGTT
ATGAAGCTGTCCATCCAGTTGGCACGATCGCTGAGCTAAAACGACGTCTAGGTACGCTTCGTAACACTTGATTGCAAAGAACGCACCACCTTACGAAGAC
TTTTATGCTGGTAGGCAATGGACGGCGATGCTTTGCATTTTTTCATCCAAGGTATTAAGATCTTCGTGAATCAGGCGTGGTTACGTATCGCTCTGTCGTA
GCTAACATGCGTCTTTTCGGTGCAGTATTCCAGATGAGCCCTTGGTGTTTGTGCATGTGGCGCTGATGCAAGAGATCGCCTCCAGTATGCAGTCTATTCG
CGACGAAACGGAACAATTATCAGAAGCAGCTCAGGCGAAAGCTGCAATCTTTTATTCCATCTCATCAACGCAAAAGGGCCTGTCGGTAGGGGCTGCCACC
TGTAGAGCGCGGTGTGATTGAACATGTACACTGACCGATGTCTTGACTGTAGGGTGTGGACCTAGGCAACTTTCTCATCAAAGAGGTTGCTAAAGCATTA
AAGACGGAGCACCCGCACCTGAAGACGTTTGCGACTCTGAGCCCTTTGCCACAATTTATGCCGTGGCTTGAAACCCAGCGATTCAAAAAGGATGAGTCAT
TGGTATCACCTCTCGAGTTGGATGCTCTGATCGATGTTTTGGAAGAGCGCGACATCACTGCCCAACCGGATTCGACTGCCGTGGCGATTGTTTTGGACGC
GCTCTCGGTTGATGACTGGAGTGCAGATCCTGATCTAGTGGCAGTGTTAAAGCCTATAATGCTGAAGCTCGGTGCGCGCTACATTTATCACGAAAAGAAG
CGAGGGAAGGCATTGGACCCCGTCACGAACTTCCACGTTCGCAATGGCGCAATTTTCGAGCGAATCAACTGGTTAGCTGATCTGTCCAAGAAGGTAGGTG
GTCCAGCTGTGATGCACATTAATCTTCATATTCTTCTTTACATATCCTACTTGTTTGTCAAATTGATGTTGTTCTCCAGGGCCTCGCGCAAAGCGCTGGC
ATGATGATCAACTACAAGTATGATCTGGCGCATGTTGAGGCCAATAATGAAAACTATCTGCTGCACAACACCATCCCCATAGGACTTCAGCCGCAGCAGG
TTCTCGGAGCGCGCACTATTTGAACAATGGTGCCAAGGTGGACGTAGTACAGTGTCAGAGCTGAAGGAACGAATTGAAAGTTTTGCCTTGACACCTTCCA
TAGTACAATCGCGACAGTTATTGTGCAGTCATTTTTGGCGTTCCGTGAAGGGTCATATATCGAGGAGCCTCGAGTCGAGCGAAGTCAAAGCGACCATGGT
CCTGGCGCAAGACGAGATTGATGCCTGTCGAGAAGCGTTCCTTGCTTTCGACAAGGATCGGTGAGCGCATTTACAGGTGGTCATACTTCGACTGTTCTCT
GATCCAATAGGTATCGTGTAGGAGTGGCACAATCGATGTGTGGGAGTTACGGCAAGTGCTGGAAGGTAAACGAAGTATCTGTGGGGTCTTCGATGCCTTC
TTGCCAATTTCTGAATGTCTTTATGCTGTAGCGATGGGACAACAACCAACTGAAGAAGAGTTGTTTCAAATGATCAGCGAGGTGGACGAGGATATGAGTG
GCGCTATCGGTCGGTGTCATCTAGCTCAAATTTGGCTTGACTGGGGTCTAACAGTGTATTTCATGTGATTGTGGTAGACTTCGCTGAGTTCTTACAGGTG
ATTGACAACCAAAAGGATCGAGCTGCCATGTTCGAAGACGACAGCGATATGAGTGCGTATAATGAACTTCTTGTAGGTTATTACCATAAGCATTCACATT
TTCATTATACGTGACGCGCAGTTGACGCGTTCGTTGCTTGTGGTGGCAAGCCCGACAAAAGTGGATTTGTGCGCAAAGAGACACTAGTGAAAATCATCAA
GGGCGACTTCGGACTGACTATCAACATCGAGGAGATGATCAACAAACTGGACGTGGACGGTAGCGGTGAGATTGAGTTCGACGAGTTCAAAGCTATCCTG
ACCTAGT