Description :
From Genome Similarity Track
Location :
Scaffold_62:220609- 221920
Sequence
1311 bases(100 bases per row)
GAGAGTCGTAGTACTCGCTGTTGTATCGATCCGACGTGTAGGGACCCTCGCTGCGCGCAGAGAAACCAGCCACGACGTCGCTCTTCATCTCAGGCTCTTC
CTTGGCCTTCGTCTTGATATCGACGTCGGCCTCTGTCCGGTCCCTTGGTTTCCTTGAACGCGTCGGCATACAGCTCACGCAGCACGTCCGTCTCAGAGCT
CATACTCATAGTCGTCACTCCTCGCGACTCCGCAGCTCCGGCACCTCTACCAGGAGACTGCTCCACACCACTACGCGGATCTTGCGAGACTCTGACTCTC
GCACCCCGCTCCAACCGCTCCACAGCAGTCGGAACCGACACAAGCTGCTCGTCCATACCGCCTTCAAGACTGCGGTCGAAGACTCTTTCCTCTTCTTCAT
CACTAAACACTTCTCTCTCGACCATCGTCGATACTCTCAATTACCAATACTTGTTCACTCCAAATGTCTCTTCTTGTCTCTGCTTCTCTTCCTCGCGCCA
GTTCTTCTGCGCGGCACCAACGACAATTTCTCCACAACTTCAGCTGAAACAGGAGGCTTACTTCTCAGTCACCGTACGATGGCCTTCAACACCTTACTTC
TGGTGGGCCTCGGCCTGAGAGGACAGCGTCCACGATCCAGTCACAATATTCTCACCAATCACACGACGGCTCAAGCTACTTCACAGCGTAAGCAGTACCC
TGCTTCTCCACCACGTGTCGCGAGTCGCCCTGGAACGGGACGCTTGCGCTGATCAACCGTAGCGAGCTCTAGACGTGCGGGGTAAAAAGTAATAATCCAA
GTCGACAAATATATATATTTATATATATATATATATATATATATTAATAATATAAAGCCAAATGTATTAAGTCAACTCGGGGTTTCCAGGCAAAATTCAC
GACTGACCAAACTTACCTCGCCCACAATGTCACCCGTACCGTAGTTCTACTCCGTCGAACCGCACGTCTGTACGTCCTTGGGTACACTGATGTCGGCGAC
ATCCCGCCCTTCCCTTCACTGTCCTTCGCATACGTAGCGGTATCCCTGTAGTCCGTGTCGTCCGTCCCAAGGACCTCGCACATCGCCGTGACGACAGGCA
GTACCTCAGCCATAGCGGCACCTCAGACGACGTACTCAACAGGTAGAGTAGCTCCCTCTCAATACTACACGTAGATGCGACGAGGTCAGGCCCCAATTCG
GACAACAGAATCCGACAATGTCAGAGCTGATTCAAGCGACCCGACGGCCGCTCATCCTCTTGCCGTCCGACTTCAAATGGCAGGTCGCAGGTCACTCCAG
AGGGGGAACGG