Description :
From Genome Similarity Track
Location :
Scaffold_127:22050- 25744
Transcript NameFunction/comments
Pytap_DAOMBR444snap-pag1_scaffold_127-abinit-gene-0.136Conserved hypothetical protein

Sequence
3694 bases(100 bases per row)
GACACCAGTTTGGCTCGGCCCTCGCGCAGCTACCGCCACCGAAAGaCAACGAGCACGAGATCACaGCCACAGGGGAAGGATTTGACTACCTGTACGACTC
GCCGGCGTCGTCGCCTCGCGCGACCGCCTCGTCGACGGCACTCATCATGGCATCAACGTCGTCGACAACCACAGTCGGTCCGCTCAtcGGCCCAgCTCCC
AAAGGCGCGGCCaCGGGGGCCATGAACCGCCGGGCGCTGAATCGGAACCCGTTCACGGGCTTGTCGAACCAGGGTGCGACGTGCTACATGAACTCACTGC
TTCAAACAATGTTCATGACGCCCGAATTACGCCTCGGACTCTACCGGTGGACATTCATGGAGGATGAAGATGAGAATGAGGAAGACAATATCCCATTCCA
GTTGCAGAAGCTGTTTGCCAAGCTGCAGATGAACACCCAAGAGTCGATCTCCACGAAGGCATTGACGAAGAGTTTTGGGTGGACGGGTGCTGAtGTTTTC
CAGCAGCACGATGTGCAAGAGCTCTGCCGAGTCCTGTTCGATGCACTGgAGAAGTCgTTCAAAGGAACAGAGATCGAAACACTCGTGAACGACTTGTACc
AAGGAACGATGAAAGACTACGTGCAGTGCCGCACGTGCGGCTATGAATCATCCCGTAATGACGAATTCCTTGACCTGTCCCTTGTCATTCGCCCGTTTGG
TTCATCAAAGATGATGAAGAGCATCGAGGAAGCCATTGAATTTTTCTTGAAACCTGAGCTTCTGAACGGCGACAACCAGTGGATGTGTGACAGATGcAAA
ACAAAGCGCGACGCTATCAAAGGCCTCAAGTTCTCGAAGCTCCcGTATCTGCTTTCGCTCCAGTTgaaaCGTTTTGACTACGACTACATGACGGATTCGC
GCGTGAAGCTACATGATCAAGTTACCTTCCCTAAGTACCTCGATATGAACTCGTACTTGCATGATGAAGAAGGAGGTGGCACGCGTGGAAGCATTGCCCG
AAAGATGTCTATGGAACGCCATGAGCTTGAGAGTCGTGCATCGTTCGGCGAGGGAACATCCAGCGCCCGTGACCGACGAATGTCCTCGATGGACGAGTCG
CAACCAGTTTTGGCATTCTCGGATAATGAAGGATTGCCCTCTGGCACCgTTATTTCGGACACATGGAGCCCAAACTTTGATTTAGACGGGCTGATCGAGA
AGACGGGTCCATATGTGTATGAGCTGTATTCAGTTCTTATCCACTCCGGTAGTGCCCTTGGTGGTCACTACTACGCTTACATTAAGTCGTTCGAGAACGA
TAAGTGGTACGATTTCAATGACTCGAACGTGTCCGAGCTGTCAGAGAACGAAGTAAAGAAGGCTTGGGGCGGAAATGGTAGTAGCAGCTACGGAGGACGT
ATCAGCTACAGCACATGTGCCTACATGTTGATGTATCGCCAAGTCAACCGAAaCAAAAACGTGAACTCTGTGGTAAAGGAGAGTATCCCTGAATACCTGG
TAGAACGTATGCGCGAGGAAGACGAGCGACAACGACGACAGGAACTCGAGCGCATTGAACTGGCAAAGAAGATATTGATCAAGTTTTACATGAAGACAAA
CTCAAAGAACAAGATAGAAAAGAGTATCCACGTCTACAAGACAGCTACGCTACGGGAGGCACTCGCCTTAGCTCACGAGACATTCAAAACGGAGCTCCAA
GGAGCGATGCCTTCGATCGAGAACACACGAATTCGTTTGTACAACGATTACACTGGACTTCTGAGCGACACATACGAAGGCAGAGAGGACAAAACTCTCC
AGCAGTTGCAAATGTACTCAAGTTACCAGCTCTACCTGGAGACAAAGAAAGACAATGAGACATGGGAGTCGCACGACCCGACCCGACTGCAGCTATTTGT
GCGGCGCTTTAACCTCAGCGCAAGTGGTGAACCCTTAGAGGTTAATCCGTCTGTACCAGATATGTCTGCTCGATACGTTCAAGTTGAAGAAGAGTCAACT
ATTGGcTCCCTTACTGAACTTCTATCGCACAAGTTTGACGTATCTGAGGGCAAGAAAATCCGTCTGGTGAGGAAAACTGGAACTTCGTATACTTCGTACA
ACCCAACACCTGTGAAGATCCTGAACCCTGACGAGAGTCCCCAGACACTGAGCTTGCGCCTGCGGATGGACTTACACCTCGTtAaTGGGTCGGAAATTTT
CTTTGAGGAGTGTGACGACCTCTGCTCACCATCAATTGCAGCAGCGCATTTTGAACGAGAGATCAACATGATAGACCTCAATATTTGGTTCGAAGAGCGT
TTGGCGGAAACAATCAGAATTGACCGTCGGAAGACACtCcGGGAGCTGAAAGAGGTGATTGCCATGCGTCTTAACCTTTCAGCCAaTAAGTTTAAGATCT
TGCGAGGCAACAACCGAGCCAGCCTAGAGCTCAAGAACATCGACACATCATTAGTCAAGGTTCCGATTGGGCAAGGAAGTGCCTTGTACATCGTCGAAGG
AACTCCaCTTGCTCCAGGTGAATACTTGTTCCGTCTGCTTTTCcTCAAATCACCAGCACGTGCTATTGCTCCAAGTCAGACTAGTCTATCGGGGGATACA
GGAGAGCCAACACTAACTGTGTCTTCGAAAGCCGACGGTGATGAAGAAAGAGACTTATTCGATATCGACGAAGTGCTTGTTCGAGTCAATCAAGATGAGT
CGGAACTTGAATATGTGACGAGCATCAAGGCGGGTGAGGAGCATTCTGTTGATTCAATTCGACAAACAGTCTGGTCAGCCCTCAAAGAGAGTGGTAAAAT
CTTAGATGACAACTCGGTCACCCCGAAGCATATTCGCCTGCGTGATGTGCAGGCGACCACCTTGACCACTATCCTTGTCGATGGATGCTACCTCAAAGAA
GCATCGACTTCTCCAGTATACGAAGGACGTGGTATGGTCGCGCAGATCTTGCCGGAACCGGAGGATGTTGtACTTGGCCACCGTCTGCTTCAAGTTGTGT
ATCTAGACCGTTCGAAGTGGCGATTCTGCAAGCGTAGACGGTTCGAGCTTATCATCCCAAAAGACCAGGTTGGAGAAGATGCCTCGACAGATGAAGAAGA
TGAAGAGGAAGCTGGAGATTCAACGTCACTCGCCATTTCGACTGTAGGTCAAAGAGGCAGGGCGCCAGTGTCTTCTCAAGTCAACACTTGGGCTCCTGAA
CAAATTGCCGCTCgaCTGACTATTCCACCAGAGCAGGCGCGTTTCGCCGTGTTCACAGTTGACCAGGATAGTTTCGACATCTGTGagCTCTTCAAAACAG
ACTTTGATACGTGGgAACGCTGCATGGCTAATCTTCGCGACCGCCAGTACAACTATCAGCTGCTTGTATTCGTCGCTGATGCTGATGTTCCTACGGGCTC
ATTTTCATTGCGAGAGCGCTCGAGTATCCAGGATTTCCTCGTAAAGAAGCGTGATGACAGCTACAAGACGTCAGAGCGATCGTACTCAAACTACTCGAAT
TACCGCAAaCCAAAGGAAGCAGCCCTTGTCATCCGTACTAAGACATcAAAGAAaGGAGGCAGCAGTGCTAGCAGCACGGATAACACATCAGGAGATGGCA
AtGGAGGTGTCAAAATCCGCACTCCTACTCAACGCAGGgTAAGCAAGTCGGCGGCATCGGACACAGATGAAGACGACGAGGTAAACTTGTACGA