Description :
From Genome Similarity Track
Location :
Scaffold_3:22046- 31154
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_3-fgenesh-gene-0.4Glutamine cyclotransferase
Pytve_DAOMBR484maker-pve_contig_3-snap-gene-0.75U6 snRNA-associated Sm
Pytve_DAOMBR484maker-pve_contig_3-snap-gene-0.43Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_3-snap-gene-0.44Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_3-fgenesh-gene-0.5Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C
Pytve_DAOMBR484maker-pve_contig_3-fgenesh-gene-0.28Phosducin
Pytve_DAOMBR484maker-pve_contig_3-fgenesh-gene-0.6Transducin/WD-40 repeat family protein

Sequence
9108 bases(100 bases per row)
CCCAGAATGAGCTCGAGCACGATCATCAAGGCATTGATCACAATGAGCGGCACTGTCGAGAACAGTCAGCGTTAACAGTCTTCCTCCACATTCCATACAC
CACATGAAGCCACCACCGCACCTCTCAGGTACTGCACGGCCGAGAGGAAGCCTACGATCTGGTTCTTGACCGTCAAGCCCTGTGCGGTATCCACCTTGTG
CCATCCATCTACGCGCACGCTCCGATTAGCACCGCTGACTTTGTCCCACCGCCGTGAAGATCGGAATGAGCACTAGCGCTACGTACAGGATCGGAGGAAG
CGCTTCTCGTGGAGGATGCACACCGCGTTCGTGAGCAGCAGGCTCGTGAGGAAGAAGTTCCAGAGCACGCCCATCGTGCCGTTGGTTGTTTCCTGCTTGT
TGCTGCCGACAACAAAGCGATCCTGGAAAGTACGATGCCAAACTTTCACGTGGTCCACGTCAATCGCTTCATATTTTGATCAAGTCACAGAAAGTTCGTG
ACTAAGTTTCCGACTCTCCATCAAAGTCCGGGTGTGGGCTGGCTGGGTGGGCTGGCTGGGTGTGTGGAGCCATGCCTCGAGACGCAGCGCTCAACCGTCG
CGCGCGAAAGGCCGATGCTTCGGCAGCCGCAAAGGCGGAAGTGCTCGCTCGCTCGGACTCGAGCGCGGCACGCGACGTGGCCGAGAGCCTGCAGGACGCG
ATGCCGAAGCTGCTGCTGCGCATCTGCATCACGTCTCTGGTGCTGGCGATCGCGGCGGCATTAGCGTTCGCGCTGTCGCCTCCTGGACTCTCGGACTCGT
TCCCTCGCCACCGCGAGTATTACGACGAGCTGCGCACGGTCAAGTACTCGCAGTCTCTCTCGCAGCGCGAGGCGACCGCACCGACTGTCGAAGTGGTGGC
CAAGTACCCGCACGACGCAGCCGCGTTCACGCAAGGACTGGTGATTGTGCACCACGGGCGGCGCGGCAAGTTCCTGATCGAGACGACGGGACTGTACGGC
GAGTCGAGTCTGCGCAAGGTGGAGATTGAGAGCGGCCGAGTCGTGGAGCAGTACGATCTGCCGTCGGAACTGTTCGGCGAAGGGGTTACGCTGAACAACG
CCGGCGAGCTCGTGATGCTGACGTGGAGGAGCCGCAAAGGGTTCGTGTTCGACCTTGGCAAGCCTCAAGACGGCCAGGGCGAGGATAAGTTCTCGCTGTT
GAGGGAGTTCGAGTTCGCCACGGTCACGGGTGAAGGCTGGGGTATTGACAACGATGGGGAGTCGCTCGTCGTGTCCGACGGCTCGCCCACGCTGCTGTTC
TGGGACCCGGAGACCATGACGGAGACACGGCGCGTGGTGGTGACGTTGCCGAACAATCGGCCTGTGGCGCGGCTGAACGAGCTCGAGTTCGCCAACGGCT
ACATCTACGCCAACGTGTGGTACCAGCCGGTGATCCTCAAAATCGACCCGACCACAGGCGCGGTCGTGAGCGTGTTTGACTGCTCGCAGCTCATCACCGA
TGCCGGCGCCGACGTCAACAGCGGCGCGGTGCTGAACGGCATCGCGTACGACGGCGAAGAGGACATGTTCTACATCACGGGCAAGCAGTGGAACGCACTG
TACAAGGTCCGGCTGCTCGACAGTACCCGCATCGACAGCCTGTAGTGAGACAAAAGCAATATAGAGGCACTGCCACAGTGCATATCAATGGCGAAAACAC
TACTGTCAAAGACGTCCATGCCATTGCAACTCGAACAGGAGGTCGCCGTGGGTCGTCGAAAGTGTCGCGTCCTGCCTCTATTCTTCCTGCTGCAGGAACG
GGTTGGGGATCTCGGCCGTGCCGTCGACGGGGGAGACGAGCATCACGGACGTGCCGCGGCACACGACGAGCCCGACCTTGCGCGTCTCGTCCGTCAGCCG
GTACTCGTCGCNNNNNNNNNNNNNNNNNNNNNNGCGCAGGAACTCGACGCAGTCGTCCAGAACGAGGTTCACGAGCTGGTCGTAGCCCTTGAGCACACCC
GTCACTTCGCGTCCGCCCTGGAACTTGACGCGCACCTCCTGGTCGATGTACTTGCTCAGGTCCAGGATCGGGTCCCGCCGGGAAGTCGCTCCCGCGCCGT
TCGCCGCCATCGCTTCGCCGCTTCTTGCTTGATCGGTTGCCTGTGCGCTTTCTGGTGTGGTCCCATGATCGCACCTCTGACCATCATTGGCCGAAAACAC
GCCATTTATGGGTGTGTTGATTCGCTATAAATTAAGCATCGACACGCGATTGGTTCAAAATGTCCGGTCAATGCTGCTCAGATCCAGATATCCGCGATCA
TGAGCAGTGGCGGCGTCGCGGTGGACGATCGAGCCCTGGATGCGCTCGCCGAGGCCAAGGCGCTTCCACTCGAGAGTACGTATGCACCTGTCTTCGTGAA
ACAAGGTCGGTATAGTGGATACTGAGGGAGATGTCGGCTCTGTACAGACTTTGAAGCCGTCTGCACACTCGCCGTCGCAGTTTTCCAGACTGAGAAGCAG
TCTCGCAAGCGACTTTCACGCACAGCCTGTAAGTACGCTCCTCTGCATTCGTATCGCTTAACTGAGTTCTTTGTGGCTAACGATGGCGTGTGCCTTATGG
CTGGTTTGGGACTCTGTACGTCAGCCGCGTGCGGATGGAAACCTCAGCAGCTTGAACATGCCGTGCTTGGCGTCGCCAAGATCCTGATGGATGCAGCACA
GGTACATCAGCTTGTGGGTAGCCAGCGAACAATTGAGTGCGTTTGGCTAATCATGTGGTGGGACTGTGTTTGGATCAAAAGGCCGATCTACAGGAGCAAT
CTTTCAAGACCTTGCTGGAGAACCTCGAGCTCTCCAAGGAACAGATCGACTGCCTCGCGCAGGTATGTACAGATCCTCTCATTACGAGATCTATGCTGAT
GCAGGATCACCTAACAATGCACGCTGTGATATGGCAGCGGTATCTGCTGCACAAGGCAGCCATCCACGCCAGTGTTTCGCGAGATATGCTGCTCAGCGTT
CCTCGGTATCGAAATTTCGAGTGGAGGATCGACTTGGAGGTTTATACGAGTCATTTCGCATTGACGCAAACTCGGAGCTGACGTATTGCGCTTGCTCTTG
ACGCAATAGCTCGGCACTCGCTTCCTTCGCAACGAGCCCAAGCCGATCGTCACGCTGCGGTTCGACACCTCGACCCCAGCGCCTGAGTCTGGGTTACCTT
CCGCGCAATCGACTTGCGTCCGTGTGGACTATGAAGGTCTCCGCTTGTTGCAGCGGCAGCTGGAGCAAGCGCTCAAAGAAGTTGACTCGGTGCATTGCAG
CCGCATCCAGCGGTACATGCACTGATCGACATGACTCGTGTGTGGCATCCATTGGGCCGAGACAACGACAACCGGATGAACAAGCGGCCACAACCGTGGG
GAACAACCGCGAAACGATCAATCAATTAGCACTATTTCACATGAGGAAGCATCTTGAACGTCAACTGCGGCGCTACGACAGTGACGCGAATAGTCCGCTT
GGACTGGCGGACTAGCGGGTATCGCTCCGTCCAGGGCGAGCGAACGCGGTGACGTCGTCCAGCTGCTTCTTGGTCTCGTCGGACACGTTCTTCTTCTGTA
GCAGCAGCTCCGCGAACTTCTGCTGCCGCTGCTGCCGTCGCTGCGGGTCTGGCTTCACGTAGAACTCCTGCATTTGCCACAAGCCGTCAGCTATTTGTAT
GAACAGGAGAATAGAATAGCACCCGCTCAGCTACGCACCACGTCCTTGCGGATCTCCTCGTCCGTCCGCGGGTTCCAATAGTAGAACGCCACCGCGGTCG
GGACCGTGAACATGATCGTGTACTGCAGCAGCATCATGTGGATCTTCATCGTGGTCTGTCACCTCTCGACCCGCCAAGGCAGCGAGTTCCTCAGCTGACA
GGTGAATCGAGATGCGTCGCTGCACCACCTTGGATAAAATGACGGCTTGAATGGCAGTCTGCCGAAAACGAACTTAATCGAAACCGCACTTTGCGAACTT
ATTGGCGCTTCAGTGTGAGGTTGGCAAGCGACCATGACGAGCACTCTGGCAGCTCGATGCGCGTGGCGGCAATTGCTCGCTCGTCCCTGCGGCGGGTCTG
CTCGGACGTTGGCAAGAGCGCTGCATAGTCGAGATCTTCCGGAAGGGCTCAAGGAGATCACTAGTGTACGGCCTTGTGTGTGTGTCGAGGAAAGCGGCAG
CAGGACACTCACCTAAGTGACTTGCAGGTGCCGCGCACGCCGTCGTGGTCGCTCAAGGAGCTGCACCAAGAGGGCGAGACGTTGGGCAGTGCCGATGCGG
TCCTCGATGAGGAAAAGGTCTCACTTATTGTGTGTCGCCGGCGTGTGAACGACAACTAACCGGAGGTATTTCGTTGTAGCTGCGCGAGTTGGCCGAGCTG
TGCCACCTTCGCATCAGCGACGATAAGCTGCCGTCGCTGCTCAAGGACGTCGAGTCGATCATCCAGTGCACCAAGACTGTGCAGGCGCTGACGATCGACG
AGAACATCGACGACTTGTACGCCTCGAACGACTACGACTCTCGTACGTCCGTCGCATTTGAGCAGTTAGTCAACGGATCATCGTGGCTCACGTTCTCATG
TGAGAATGACAGGCAAGGCACCGCTGCGGGACGACGTGGTGACGGAGGGCGACTGCGCCGACAAGATCTTGGCGAACGCGGCCGAGAAATCGGGCTACTT
CTTCAAGGTTCCCAAGGTGCTGCAAGATTAGATGTGTGGGAAAGGCATAATCATGCACAATCCAGAAATCTCTATGAAAAATAGCGTGACATGCGTGCAC
ATCGCAACCAAGGCGCTCGTAGCGCTGCTGTGCTTGCCAAAGGGACTAGTCGGTCGCGTTGAACAGCCCAGCATTGGCGAGGTACTCTTCCAAGTCTGGC
ATAGCTCCGAGTTAGACACCACGTTCGATAATCCCATCATGCACGGGATAGACTCACCTTCGACCTTCATCTCGAGCCCTCCGAGCTTGCGAATGCTGAG
CAGCTGGTTCTTCAGGTCGCCCTTGTGGTACATGAACAGCGTCGGACAGTTCCTGGGGACGGCATCTCCGTGAGAAACAACCTTCATCACTAGTCGACTG
CAAACAATTCGCGTACCGGGACGGCCAGTTCTCGATGCACGTCTGCGCCTGGATGCTCACAAACTTGACGTCGCGGTGCTTCTTGGCGACCGCTCGCAGC
ACGTCGTCCATCAGCTTGCACTCCTGGAGCGCGTCGTCCCACAGGTACGCGACGACCCAGTTCTCGCTGCTGCCCTCCGTCACCTCGCGCGTCCACTCAT
CCTTGGCGATCGGCTGCACGTCGCCGAACTTGTTGCGCGCCGCCTGTGCCATCATCTCCGCGATGCGCTTCTCGCTGGATAGAGAAATATATCAGCGTCA
GCTTCGCCATTAGATTCAACCCATGCGCAGTTCGAGCAGTAAACCGCACGCACCGAATACGCGCGAGCTCCATATCGTCGTCATAGCCGTCCTACATGAA
AACGTCACTCGATCAGTGAACATTCGCGCGATGTACGCCACTACAAAAGAAAAGAAAACGACTCGAACCTCCAGCTCATCCAGCTCGTCGAGCGTGGCGT
ACTCGCGCGGGTCCACCTGCTCGCCCTCGCTCTCCTCCTCTTCCTCCTGCACCTTGGTCTTCGGCGCGAGGATCCCCTTCTTGATGAGGATGTCCTCCCA
CTCGGTCGTCTCGCCCGTCGGCTCGTAGAACTTGTTGCCTCGGTCTCCCATCGCTGCCTTGTTGTGTTGTGATGCTCTTCGAGAATGTCTCGCCACACAC
ATTTGCAATTTCGTACATCCAATCAGCTGTATACTGTAATAATTATTTATCTTCAATTAGTGTCTGCCACGCTGTAATAGTTTGACAAGGTCAGCGCCTA
GTTGTGCACCACTTCCGCGCGCTTTTCATTTTTGGCGGCAAAGGTCTCGCCGCCTTATCGGACACTCGACCATTGCTCGCTTTGCCGCCTGCCTGGCGGG
GCTGCGTCGGTGCTTCAGTCGGCTACCATGGACACGATGAAGGAGCTGGCTGTGAACGTGGGCGGCATGGGTGCCATGCAGGTGCTGACGACGAAGAAGC
CGCTGAAGGATGGGAAGATCCCCGCGGGTAGCGATGTTGTGCTCACGAGCGGCGAGGACGGCGTGTTGTACGTGACCGACCTTGACAGCGAAGAAGTGGT
CCACGACACGGTCATGTCGGACGGCGGCATCCCGTCGTTCGCCGTGCTGCCCGACCAGTCGCGCGTGCTGCTCGTGTCGGAGGAGGACAATGCGGTGTAC
TCGTATCATCTGCCACCGGCTGAGCAGCAGATGGACGCGCTCATCGTGCGCTCCACAGTCTCAATCCGCCAGGTGGTCTGCTCGGACAAGTACATCGCCG
TGGCTGAAGATGACCCGAAAGTGCGCGTCGTGCTGCGCACCAATACCGACCAGGTGATCGCGGTGGAAGGAGCGGATGGCGCCATCAAGAGCGTCGCCAT
CGACCCAACCGACAAGTTCCTGAGCGTGTCCAGTGAGGACGGTCACGTGCGCGTGTACGAGCTGGAGGACCGAGCGCTGACGGCGACGCTAGTCAAGTCC
ATCTCGGTCAAGTACTTGGACATCCGCAGCGAGTTTGTGTTTGCGCGCTGCGCGTGGCAGCCGCAGCCTGGTGGCCAATTGCTCGCAGTGCCAATGGACG
AAGGCATCGTCGAGCTGTACGACAGTTCCACGTGGAAGCCACGCACCAAGCTGACGCTGCCGAGGGGGAGCAAGAGCTCGGACATCAGCGTCCTAGCGTT
CTCGCCGAATGGCCAGTATCTCGCGGGTGCGACGATCGCGAAGGAGATCCACGTGTGGGCCATCGGAGATAACTCTGTCGTGCGGTCCTTCCGCGTGGAC
AACGAAGTGCTCTCGGTGGCGTGGGGCAACACTCAAAACACGCTCGTCGTCTACCACATTGGCGGCAAGTTCGGGTTTGTCAAGGACGTCATCCCAGCTG
GCAAGACGCCTCCGCACTTTATGGGTATGATTCCGTCTTCCGTCGCTTCGTCGACTGCAAGTGCAAAACATTCAAAGACCGACCGGCCGAAATCAGTCAA
CCCTTCCAGTTTTATCGACGACGAAGCTGTTGAGGAGCATGGAGGTGACGATGATGAGACTGTCGAAATTGAGGATGACGACAACGAGGCACGCGTCGAG
GCGATCAAGGCGAGCTTTGGTTTTGGCCAGGCGAAGGCAGACGACGATGTCGACCAGGACATGGAAGACCCCTTGGTGTCTCAAGCGACAACTGGCGGCG
TGTATCGTGGAAGCACTGGAACAGGATCCTCTCCGTTTGACACGCTCACAGAGCCCTTTCAGCCAGGCAACGTTCAAGGTGACAAGGGACGCGGTGGTGT
CTCCTTGCTCGCTTGGACACCGGCGGGCGAGATCGAGTCGATTCGAGGCGCAAACCTGAGCGAAAACCTCGTAAAGGTCGAGTTCGTCGACAAGTCGCGC
CGCGGCTTCAAGTTCAACGACAACTACCTCTTCACGATGGGGTTCTTGGACGATCACGGCGCCATTTTCGGCGTTCCGCGACGACCTCGTGAGGAGTGGG
ACGACGAAGTGAGTGGTTCGGAAGTGATCAGCAGCTACATTTTCTATCGGCCGTTCGAGTCGTGGGCCAGCAACAGTTCGTGGCACCTTGCATTGCCAGA
AGGTGAGGACGCTGAATGTGTTGCTGCCGCGCGAGAGTTCTGCGCGGTGGCGACCACATTGCAATGCGTCCGCATCTACACGACGAGCGGGATCGAGTAT
GCCCTGCTTCGCCTGCCTGGACGCATTGTCACCATGACGGCGAAGGAGTCGCTTCTCGCTGTCGTCTTCCAAGGACATCATGGCCAACTTCAATATCAGC
TGCTCCGCATTCGCGTGAGTTCATCCCACCAGCGCGTCGAACTCGTCACGAAGGGTGTTCTGCCGCTGACGCCTCCTCCTCGTGATGTGTTCGCGTCCCA
CAAGGAGAACCAGGTTGCGCGTGGAGATTTGGCGCAATGGTCGAAGCTGTCGTGGCTCGGGTTTGACGACCGACAGATCCTGTACAGTGTGGACTCGTTC
GGGTGTGTGCAAGCTCTGACGCAGAGCATGGGGTGGAACTGGTTCCCCCTCGGATGTGTCGGGAACACGCTCAACAAGAAGCCTGGCGATCGCCATGGCA
TCTTCACTCTCGGGATCGTGAACGACTCGCTGCTGTATTTCCCGCTCGAGAATGAGGCCAAAGCGCCGCGTCTTCGTGGCAAGCATCGTCCCGTTCCGCT
GACATACGCGCTGCAATTTGCTGCCTTCCCGAAGTCGACTGCTGCTCAGTCCGGCGACGCCAAGTCAGTCAACACTATGTGGCAGAGCGTCCGTCTTGCA
GGCGTCGAGACGAATGTGTTGAAGCACTGCGATCCCCGCGACAAAGACACCGTCAAGGACCAAGTGGTGCACGAGAAAGCCGAAATGGACAAGTCTCTGA
TCTTGATGATGAAGGCCGCATGCACCAACGACGAGTCCGCGCGCGTGCTCGACTTGGCCAAGTGTCTGCACCTGGAAAAGTCGCATCAGATCGCGCAGAA
ACTCGCTGTTCACTACGGTCTGCGGCAGCTGCAGACCCAACTGTTCGATTTGTACCAGCAGCGCTTCGAACAGCCTGACGAAGACAGCTACAGCTACGCT
CCGCCAGCTCGCCACGAGGCCAGACCGACGTCTTCACAGCAGCGATCGTCAGCGCGTCACGTCGAGGCTCCCCGAGCCTCGCGGGAGCCGCTTCAAATGG
CGCGCAACGTTCTTGCTCGACCGAAGGCTCCGCCTGCAGTGGAGTATGTTGAGGAAGAGCTCGGAAGTCATGAGGAGCCGGAGCTGGAGTCCATATCGTC
ACCAGTGAAGCCCGCCTCGAAAACGGCCAACCCCACGTCCACACCGGCTTCGATCGAGCGATCAGTGGCTCCAGCGAACCCGTTCCTGAAGAAGCCGAAG
GCGAGTGGAGAGGCCGGCGACGACAAGGACGCCACCGTTGCCGGCAGGAAGAAGTCTGGACTCGAGCGGCTGGCCAAGTTCGCCTCGCCTCCTCCAAAGA
AGCGACGT