Description :
From Genome Similarity Track
Location :
Scaffold_33:220455- 240111
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13507RIO kinase
Phypa_INRA-310PPTG_13508hypothetical protein
Phypa_INRA-310PPTG_13509hypothetical protein
Phypa_INRA-310PPTG_13510hypothetical protein
Phypa_INRA-310PPTG_13511DEAD/DEAH box RNA helicase
Phypa_INRA-310PPTG_13512kynurenine-oxoglutarate transaminase
Phypa_INRA-310PPTG_13513hypothetical protein
Phypa_INRA-310PPTG_13514hypothetical protein
Phypa_INRA-310PPTG_13515hypothetical protein

Sequence
19656 bases(100 bases per row)
GCGTGTGTTCCTGCAGCGCGGCCACATCACGGGCTTGGGCCGCCAGATCGGCGTTGGCAAAGAGTCCGACATCTACCTGGCCACACAGGAGGACGGCACG
GAGGTGGCCATCAAGTTCCACCGTCTTGGACGCACGTCGTTCCGCGCCGTTAAATCCAAGCGAGATTACCTGAAGAACCGAAAGTCAGTCAGCTGGTTCT
ATATGTCACGCCTCTCGGCTATGAAGGAGTACGCCTTCCTGAAGGTAAAATTGTATCTGATAGCCTTGGCCCTTTTTGTGCGGTCCCGCTCACTGTTGGT
ATTGTAGGCCCTGTACGACCGTGATTTCCCGACGCCGACGCCTATCGACTGCAACCGCCACGCGATCTGCATGAGTCTTGTAGATGGCTACCCGCTTAAC
CAAGTGCGCCGTCTTGCCAACTCGAAAGATGCCTATGACACGGCCATGTCGATTGTTGTGCGACTGGCGGAATACGGACTGGTGCACTGTGACTTCAACG
AGTTCAACATTATGATCGGAGACGATGGCAAAATCACCATGATCGATTTCCCGCAGATGATCTCGACGTCGCACCCGAACGCTGCTGAGTAAGTGCAGTT
TCGGTGTCGTCGCATGTACACACTTTCTGACATGCTGTTTGTCCGCAGGCTGTTTGATCGCGATGTGCACGGACTCGTGAAATTCTTCTCGCGGCTGCAA
GGCGGCGCCTACACACCTGACGTAAACAGAAGTCTAAGCAGCTATGCGTGTGATACGTGATTGTGCTGATGATGTGTTTCCCTGCAATTATAGCGTGTTC
CGAAGCTGAAGGACATCGTGGCCGATGAAAACGTCCGATTGGACGAGGATGTGGAGGCAAGCGGCTTTGGCAAGGAGTTTGGCGAAAAAGTGCACGACGT
AAGATGCTGTTTCATTGTAAAATATGATGTGCGAGTCAACAGACTGACTGGTAATTGTTGATCTTCTGTTGACGTAGCTCTCGATTTTCTCGGCTCACCA
GAACGTTGAGGAAAGTGACAGTGACGATGATAACGAGGACGAAAGTGAAGAGGAAAGCGAAGGAGAGGAAGAGGACGGCGACGCAGAGGTACCGGACCTT
GTACAAGGAGTTGAAGCCACGACTCTTGATGACCAGGCCGATGGATCCGAGGAGGAGATCAGCGGTGAAGTCGACGATGAAGAAGCGCAGGATTCGTTCG
CTGTAGAGAACGAGATCATTAAGCAGCGAGTGCAACGCGATCGACAGGCACGCCAAAAAGCAGGTGGCAAGCGACGGTCGCGCAACTCGGCCAAGCTCAG
CATTAAGGGCAAGCTTTACCACAAGAACGACTGGTAAACGTACGAAGGATAGTGCAAAGGCATTTTATCGCTAGCATCATATTGTAGACCGCTGATCTCG
TAATACATTTTCTTGCTTGCAGCTCTTGAATTTGTATTATGAGGTCAAATAAGAATTCGGTTGCGGCGAGAGTCATCGCAGCGGGTATTCGGACGGCTAT
TGAATAACACAGGATGCGCTTTGCGCAGCTGCGTCTCCCATTTCCTTGAGCACTTTTACTACAGCTTTATGTTTGCCGTCCATTGCGTAGTCGAAAGGCA
ACTTCCCGTTTGCGTCTTTCTTGGCGGAATCCGCCTTGTTCTCCATCAGCAGTCTAACTATTTCCACTTTACCGCCCTCAGCTGCGCCGTGGAGTGCCGT
CATCCCCGTTGTGGTCTCTGCATTAATGTTTGCTCCCTTCTGCAGCAACACCAATGTAGCCTCTTTGTGACCACTGATAGACGCCCAATGTAGTGCTGTT
CGACCACTTTTATCCGCCTACAAAACGTAAAAAAAACAGCAATATCCTTTTAGCACTAAACACAAGTGACTACACAAGATACAAGCACGTACCCCGTCAA
TTTCTGCGCCTTTATCCAGTAACAGCGTGCACAATTCTGCGTGATTACCTCCTGCAGCACGGTGCAGAGCCCGTCGATCGCCAGCTCCAGGTGCATTGAC
ATCTACTGACTTCTCCTCCAGAATCTGTAGGCAAGCGCCCTTGTCACCGTTGTGAGCTGCCTTGTGGAGCGGTGTGTCCGATGGCATTACTCCAGCTCTA
TGGTAGTGGGTGCGAGTAGATCACTGGATTGGTATCAAAAATAAGCAGCTCACGCAGTCGCAATCGGCTCGCTATGATATCTCTACGAAACAAAGCGCGC
AGTCGAGAGCGGAGTGGCGTCTGCTGTCTCTTGTCACGTACTGCTCCTGGCCGGAGATGCGGGTCGCAACACCTTAGCTGAGCTTATCTATGCGTCGCAA
GTAGCAGTTGGCAATTGCGTCTCCGTCTTTCCAGTGGACGCACAGGCATCCCAGGAACTCTAGCTATCCTTGGCGTTTGGTTTCATGTTGCTATTGTTAG
CTTCAACTTCGACCTTTCGTCTGATTCGCTGAAAATAAACTTCAACTTTGGACGCGGAGTGATGGTCGATTCGGCAGTGCTCGTACTGCACACTGAATTG
CAATAGACCGCAGCGTGGAGATGGAGGATGAAGTCAAGGCGCAAGGAAATGGGGAGGTTGATGCAATGCGTCTCATTTCTTCGAAGAAGCGCTCGCTGCT
GCCGATCCTGCCGCAGTATCCGATGCCCGCGGGAGCTCTAGCTGTTGATAAGGAAGACACTCGAGTAGGTGCGGGTGTGAGAAACAATTGCGAGCGCATC
ATTTAATGCGATTCGTGGTGCTGACCAAATGTGCGCACAATTTGTCGCCCTTATAGTGTACTTGGCGCCGTTGATGTCGACATCGAACGAGATTTTCTTC
TCCAAGCACAAGAAACTATTGAAAGGGGCCAGCAACGCGGTACCCAATAATGAAAAACAACAAGGAGAAGATGAGTCTAAGAAGCTGGCGCTGGCGTCGC
TGGAGCGGCAATTAGCTAAGACTAAACCCCCTGTACAACAATTGGGATCTCTGAACCAACAGCCCTCGTCGAGCGCGTTTGACGTTCCGTCACCGGACGG
GCTAAATCGCAGTAACGTACTAAATGTCACTACAACGGAGGCTGGTGCTGCGGTAACGGCGGATGATCAACTGAAGAAAATGAAGCAGCGGCTTAAGCTG
CTACCGATTTCAGATGATGACCACGCTGCTTTTTGGGAGACAATTCGGGGCTATGAGCGCATGCGAGCGTACTATCACCGGACTGTATTAGCTGGTGGTG
CTTCGTCTCCGATGGGTTTCAACATGGCAGCAGCTTTTAAGAAAATGGTAAAGCAAGTTGCTGCATGGAAGAGGATTCTACAGGGTCTAATTTTTTTTGT
TTTGCAGCTACTCCAAGAGCGACACCAACAGTGGGTTAGCACACACGAAAATCGACTCGAAAACAACAGAATCAGGAAGGCACAAGAAGATGAAAATTAT
GAGCGCAGGGTGATTGAGGCTTCCTCCGAGTTTCGAGCCCAGACACGCCAGCAAAAACGTATACGTGAGCAGTTACTGTACGAAGCGCAAAACATGCAGC
CCATTGTAATGCTGAGCGCATTCACGCAAAAAATGCTGAATATGCTTAGACTACACTGGAGCCAGCATCGTCTAGAAAGCCACCTTTCGCGGACCATCCG
AATCTGGAGGCAGCATCGCGTAGTCAAGCACAAGAACGCGAGCGCAGCACATCTTCTAATTGAGTGGCTTCAGAAAAGCGTGGCTGTGAAAAGTGTCGGC
TTTCGCGTTTTCAGAGGATTGCGGATCTTTATACGTCGAGTAAAACTCGTTCAAGGGCTGTGGCGGATGAAGCAAGGCACTCGAAAACTTAAGTTCCTGA
TTATTGAAAAAGCATGGATTGAACTAGAAACTCAATACGTCGATGCCGCAATCGAAGAACACGAGGACAAACAGTTCGAGGTGAGATGGTAGCTTTAAAT
TCGTAGCGATATGCCAGAAACTCACCTCATACTTTGTTGCATGTTGCAATCTTCGAAGGCAAGGCTTGGATCCAGAAAAAAGCGCGATGTCTGGATGAGT
TTCGTTCCAGAATCATTTCGAACGCCAGTCATTCTCGAGTTTCTGCACAAAGTTGAAAAAGAGTACCAAGAGAAATTCCGCAGACAAGAGGTTGATTTTT
TTCCTCAGCTAGTTCAGACACTCCGAGGTGAACATCCCAATCGAGCTAGAACCTACATCCGAGCCGTGGCGACTCAGCACGCGTTGTGCGGTAGAGTTGT
TGAAACTTTACTGCGGTACCCCGGGGCAGTCGGCAACGATGTTGTCGTCGTCGAGCCTTTTGACGTTCATTTGGCACCAATTAGTGAACTGATAAAAGTA
GGCCGTGTCCGGTATAGTAACCGGCCAACTTCACGATCGCCCGTTCGAGCTTAGTGCCAACGAGTGGTCACTTTGACGAGTTAGCTCGGAATCGGAAATG
CAGAATGACGAGCAAGTGTGGAGGGTACTTGAAGCCAAGTCCGCCGAGGAAAGCGAAATCTACAGAAAACAATTAGCGTTGCTGCTTGAGATACGACAGC
AGCTTCGTCAAATGTTTCCCGTAACTCAAGGTAAACACGTCACTCATTTACTCAATCAGCAAAAGATCTTTGGCTCTCATTATTTACTTTTCGAATGTAG
ATACCATTGAGCTTGCGCTACAGCCTGCACCTGCAAAGCATCCAGAATCTTTACACTGTGATGCCCAACAAACCCCAGTGGTACCTAAGCAATCGTTTGG
ACTAGTAGCCGTATCCTATAATTTTAAGAACCTCCCGGCACTATCGGAGAAAACCAAAGAGGTGGCAATATCGCTGTTCGACAGTCTAGTTGGCCAACGC
TTCAACCACTTTTCGCAAAGGGGCTCCAAGCTGCTGCTGAACCCTTCAGTTATTGAGTTCCAAGATACCATGAAAGAGCTCAAGAAGTTATGCGCTGACG
AACCAGATTCTTCGTTTTTCATGTGCTTGTCGGTAAGCAATAGCTTGGAATTCTCACTACCACTTTACAGCAATTCACCTGCATGTGTAGACTCATGGTG
CTCGAGTTACTCGCGGTGCCAACGAGGGGTCATATGTGCTGTTCAGTGAAACGAGGCTTTCGTCAGAGGAAGAGCTAGTCCTAACGGCCATTCATGAACG
CGAGCTTGCTGAAATGATTAATGGTCAGCACGAGTATACGTTCGTGTAAACCAACAACTACATTGTAATTAACCAAAAAATTATGCTGCGCACAGATATT
CCGTGCAAGAACAAGTTTATTGCACTCGAGCTTTGCCAAATCCAAGAAACCAAAGACAGAGTCGACGATGATACTGAGACGATTCATCACCGTATCCATG
AGCAGTTTTTCTCACAGTTATACGAGCAAATTGTGCAACTACGACTTCAGGGCTTACCTGAGAGCGGAAAGCGCCTACCTTCAAACGAAAAAATTCATGA
GAAAGCAGTGCGAACCAACCCCAAGTTACTTAATGTCATAATGGTGGAGTCGTGTAACGTGAACACCGAGGCCCCAGTTCGAGCAAATGAAGAGCGCGTA
AGCAACTTTTTGCTTCGATTTCGTGATGCATTTCGGGGAGCCGCAATAATACCAGAGCTGGACAAAGAAAATGGCTTTGAGCAAGATCCTCGCCCGTCGC
TTTTTGCTAAAGACGTGCTAAAATATGTTTGCAAGGCTATTCGCGAGGATGCTGCAAAGCACAACGCTCTTGTCCACTCTGAATACAAGAGTCAGGTTCG
AACAAGATATGAACACGCTGCCGAGTTCCAGGATATAACTCAAACACCTTCTGTATTAGGTGCTGAGCACGCGACTGACTTCGGACTAGGGGAAATACCA
GGTACGTGAAAAATAAGCACATCAAGAAATATTGGACATCATCTCTAACTTTATCCATGTAGAACCACCAACCGTATCGCTGGCGCCACCTTTATTCGTC
TCGTCAACTTTAAACAGCATCACTTTAACATGGGCCACACCCGTTTCAAGTACTGAGGTTCCGACTGTGCTCGGATTTCACATCCAACGCCGTGGTTTCG
GTCGGGCTTGCGCCGATGGAGCAGGTGAAGCGAGTGTTTGGAAGAGAGCTGCTGCTTTCCAAGTCTTATGCTACGAGGACGTTGCGAGAAACGGAATGAT
TCCTCCCACGACAGTCACAATATTTGGACTAGCAACAGATACAGCTTACTGTTTCAGAGTTCGCGCACGGACTGCTGGAGGCTGGGGGCCATTTTCCCCC
TCCACGACAGGTTATCGTACACAGTCCGCTACTTCTACACTGGACCAGCACGAAGCCATTCGACTTGCTGCAACCCGGGAAGGTGCAAAGGGTATCGCAA
AACTGATGGACAAGCACAAGAACGCTGGTGCTGTCCAACGATATGCGGCAGAAATTCTAGCGACGATGGCAATGAAAGGTACTATTTGAATTTATGCTTT
GGGTTTGTGAGTTAGTTCAAGTCGTGGTAATTCTCGAAATTCGATAGGGAGCTCGTCAGTTGGTGGGCGAAATGGTGGTATGGGATCACTTGAACCTACC
GATTTGCCCGTTGTGATCGCCGTTCGAAATGCGATGCTGAAATTCAAGAAGGATATGCATCTCCAGCGACAAGGTTGTCTTCTGCTTGGACGTCTTGCAG
GATGTAGTGGTAAGTGGTGAAAGTTAAGTGGAACTTGCACGTCTACTGCTAAACAGCCGATGTCTTCCTTGCTTCACGTATACAGCATCCTGGAACAGAG
CACTCCAGTCAATAGGATCGCCGTCAATTTCAAGTATCCTACAGAGTATTGCAAGTCGAACTGAATGTGACTACAACAGCGAACTCACTCGCACTGCTGC
TTGGGCTCTCAAGCAAGAACAAGTTGGATCAGTATCTTTGCGGCAAAAACCACAGCGAGTACTCACTGAGAACGAAGCTGCGGTTCGACTTCAAGGTCTC
TATCGATGTCGAAAAGCAAGAGAGGGTGTACGAGCGCTGGCACGTTTGGTGTACGCCCAAGCGATTGATCCAACAACCGGCATGGCCTACGTTTACAACA
CACGCACGGGAGCTACGTTTTGGGAACTGCCGCAGTTCGCTTCGTAACGAGAACTGGAGTGAAATGAATAGTATTATCCTCTATCTTCAATGCCAAACCT
GGTCAGGTTGCGAATCCACAAGCGTATGAAACTAGCGCCGGGCACGGCGCTGAGCTCTTTGCATTGCGCGCTGGACATGTTGAGATTTCTTGCGCTTGCG
AATCCGCTCCTCGCGCTTGGCTGCCTCACGCTTTTGCTCCGCCGTCTTCTTCACCACCTGTTCTTTCTTTTTGAATCGCTCCTTCATCTTCTCCTCCGAA
CGCTGCCACTTTGATTTCTTCTTCATGTCTCCATCTTCGTCCTCGTCATCCTCGTCATCAGAACTATCAGCCTTACCAAGCAGGGCCTTCTCGTACTCCT
CCTCTGTGATTTTGCCCTTCTTCATCTTTTTGTAGAGCTTCTCCTCCTCAGCCAACTCGTCCCATTCCTCCACAATTTGCTGGTGCAGACCCTTCTTCTT
TTCACGACGACGCGGATGCTTTTGATTCTCCTCGTCAAGCGGTCGTTTGCGCTTCTTCTCGCGCATTTCAGCGTTCTTCTTGTCCCGCGCCTCGTTCTCC
TTCGCAATGACTGCCAGTTTCTTCTGACGTTCCTTTTCGCGAGCCTTGTCCTTGTATTTAATGTCAGTAGTCTTGATGTCTGTCTTCTCAAAGTTGATGC
GCACATTACGCAGCTCATTAATCTTGGGTAACTGAAGCAAACAGAAGCCACGTGCAGCAGCACCCAAGTCGAGCTCCTTAAAGCGGAAAATGAACTGGCA
CTGATGCTCTTTATACGACCGTACAAACGCCATAAACGCCTTCGTACCTTTCTCGAGCAGATCACGGTCTTCCAGGATGAACGACTTGACCTTGGGCAGT
ACATCCTCCATCGTGTCCAATGGGAGCGTCATCTCTTCGCACGGCACCTTACGAATCTTCAAAAAGTTCACGTATGCGTCTTCATTTGATGACAAGAAGG
AGAGAGCGCAACCAGAGCGTCCAGCACGCGCTGTACGACCCACACGGTGCACGAAGAAGTTCGGGTCTTGTGGAGGATCATACTGAACGATCCAGTCCAC
ATCGGGCAGATCGATACCACGCGCCACGACGTCCGTGCACACCAAAAGCCCCGATTTCAAGGTCGAAAAGTGGTCGTAATTCGTTGTACGCTTCTTCTGC
GGCATTTTGCCGTGCAGTGCCACAACCGGGAAGTCATTTTTGCCCTTGAATAATTCCTCCAACACACGACTGAAAAAGTCCACAGATCCGCATGTGGAGA
AGAAGACAATGAGCTTCTCGCCCTTCTTGGACTGCACAAAGTGGTGCAATGCTGACAGTCTCTGGTCGTGACCTACCAAACAGTAATAATTCTGTAGGGT
GGCCGGTGTAACCTGCGTATTGTTTGCTACCTGTACGGAGATTGTTGCAGGGTTACGCAGTCCAGCGCGTGCCAAAGCCTTCACCTCTTGAGTCTGCGTG
GCTGAGAATAATCCTGTACGTCTTTGCTTCGGTAGATGCTCCAGAATTTTGTTGAGACTCACTTCGAAGCCCATATCCAGCAATGTATCAGCCTCGTCCA
GTATGAGCATCTCGAACTCACGCGTCTCAACGCTGGAACCCACACAGCGGTTCAGCAGGTCCTCCGTTCGGCCGGGTGTGCCAATAACTACTGAGCACTT
GCCCACCGCGCCGCGGATTAGTGACAGGTCCTCGTCAACACTAGTGCCGCCTACGAAAAGCAGCAGCTGCACACTTGGCAGTGCCCGGGTGAAGAATTTC
TCCGCGCACTCAAAGATCTGACGTGCCAACTCGCGCGTAGGCGAGATAATCATGGCCACGAGTTTAGTGAGGTCGGCGTGGCGTGGTGCCGTGATGCTTC
CGTCCGCCAGTTTAGCCTTGAGTAGCTGTACAATGGGCAACACGAAGGATAGCGTCTTACCGCTTCCTGTACAAGCGTCCACACATACGTCCTTGTTGGA
TAGAAAGAGTGGTAGTGTGGCCGCTTGGACGGGCGTCATGTGCTCGAAGCCCAGCGCATCAGTCTCCGCCAGGATTTCGGGACACAACGCCGGCTTAAAG
TCGTGAAACCTCATGGCGACGGAGAAGTCTGCTTTTGACTGGCTTGGGCAATGATGGCCAGCACTTTTAGAAATATATCTAAAATGCTTAATGAATGGTT
AGAAAAAGGTAGCCATAATTGATTTCAACTTGGATACAACTTTGCTACTGATTTGTTAAAACCTGTTGGAACGCCCATCCAAAATAAACGTTATTAAGCC
CAAAATTGTATTTTAAATCGGAGTTGTACTTTGTCGTAAAAATGACTTTGAATCATACTTAAACCAATTTAGAGTAAACTATCTCTCTGCCATTCAGATA
CTCGCCCTTCATTACAAACTAGCCAACGACGATTTACTCTGCTGACTACAAGTGGCGCGCGGTGACTCTACATTATGCATAGGCTGTACCATGCGAGGTT
GTAGGGCGTGTGTTAGGAGTATCTGGACGTGCTGTTCGTCGATGATATACCCAGTTCGAGGAGGCTGGCCACGTGCTACCAAAGGAGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTATTTATATTAATTGACTGCCCAAGGTGCTAATAAATAATGCCATCTTGGTTATTGATAACTAAATAATGGTGCGTTC
AACTTATGCTTGTATTGATTGACATGTAAGGCAACTGCTTGATGAGTTGGTCTACCGTAGAAACCGCCCAAAAACGGGCGTTTTCTCGTAAGAAGAGAAT
CATTTCCAGCGCAATGGGCTGCAAGCCATTCGTTCATGCCGAGTGGCCTGCGGGCAACACTTAAGAACTGCTCCACCTTGTTCGAGGTAGCTGGTATGCT
ACCAACGAGACGGTAACCAGCCTCTCTAGCTTCGAGACAGCGGCGCTTCTTGAGGCGCTGCTCAAGAGACTCCACCTCGGCACCTTCGACCTTGTTGTTC
GAGACCCGGCCCGACAGGAGAAAAGGACGAAGGGCCAGCTTCTCTACAGTGGTGAGGCACTGTAGAGAAGCTGGCCCTTCGTCCTTTATTTTAGCACCCG
GACACAGCCCGATTCAAAGTCAGGGCTGTGAACAATGCTCGCCCGAGGGCCTGTATACATATATAGTAGTCAGTAAATAGCACAAAAGCAATAGTAACTT
GACAAAACGTCCCGATGTGATGCATCATCGCGAAAGTTGACCCCCAGCGAGTATCCTGGCGAATTATTGGTCGAAGCGGAGTCTCAAACCTAGTAAAATA
CAGAAAATAGTATTAGTCAAACGGATATTTGTGCTAATATCGATAGTAATATCAATTGTACTTACCGAAGTTTCGCTTACTGTTTCAGCGTCCGCAACTT
CGACACCAGGGCTTGCACAGCAGATGAGTCTTCATCGTGTTAGTGAGGTGTTGCTGGACGGCCCGGGTAAGTCGGTGACTAGCGCAATTGATTAACGGCA
CTTGCATAATGCTTGTCAGAGTTCTGTTCGCCGAATCGGTGTCTCCAAGCAAATACTTGCAGCAGCTTAGTTCTTTCCCAAAATCTCGTTCGAGCATACC
AGCCAGAAACTCCGGCAGACAGGTCCCTGCCCGGCTCGTTAATGACAAGGTCCATGCAGGAGCGTTGAGCTTTGGACCGCTTTGTAGGCAATGGCCTGAT
CACAACCGATCGTTTTATTGCGCTCTGAGAGCGCGTTTTTCTCGCAATCGACTCCGAGGCGGACATAGCATTTGGTGTTGCTATTGCGGCTGGGGTCGCA
ACAGGTCTTGCCGATGATGTACTGGCAGGAGTGGAAGCGGGGTTTACCCCAGAGGATATTAAGAGCGGTGATGCCGATGGACCCGCGCTGCTTGATAGTG
TTCGCATTTGAAGAGGTGGCTACCAATAATTACAGCGGGCAGCGTCTCGGTGGCGCTGTTGTTGTAGGCGGCCCTGCAGAACTTGCACTCAGTATGATTG
TACCCACCTTTTGCCCTACCGAATTCGGTTAGAGGCACAAAGTGCGCTCCTTCTGGGCATCCTGGCCGACCTCCTCGATGACCAGGCATCTTCTCGTTGA
GCGTGGGCGAGATTGCGTAGTGAGCACTAGTATAATACTTGAAGTTAGTAAACTAACTTAAACAGTGTGGTCCACTCTTAAAACGTGGGCTCCCGGCCCG
GTCATAGCCGAACGGCAGAAGCACCGTGACGAAAATACGTTCGGCCAAATGATAAACAGAAAAGTTTCGGCCGCACTGCCAACACTATGTGGTGCTCTAT
GACTGGGAGCTATTACGTATAACACAGCGCTGCCGGTCTTCGAGAAAGGCCATGTCATCCTCCACAAAAACTCGCAATTTTTGATTTTTAAAATTTATTT
AAACTTAAATTTGATGTCTTCCACCACCACAGCTTTGACATTATCATCATATTTTCCGCAAGAGCTCGCGATATTCCACCACCAATGCTTCGCGTCGTTG
ACACTATCCCCAATCTGTGAACGACCGATGGTCTCAAGTATCTTGAGTCAAGTTTTTTTGGAGGTAGGCCTGGGAGCAAGTTCGGCAAGTTGGTTGGAAT
CCCTCTTGGACATGGGCTGTGAAAACTGCGTATTGTAGTTCTAGCAATCGTAAACCCGGCCGATCAGCGATACCAGGCGACAATTTGTTGTTATCGCCTC
ACACTACTCTTCCAATCTACCTCGATGATGCGATCGGATACTTTGCTGTAAGCTACTCGGTCTCTGATTGGTCCATTCATTTAACACCAAATTTGCACAC
ATTTCCGCCAGCAATCTCCATTTCACTGTCATCATGGCGGAGCAGCTCGCTAAACGCCTCAACGGCTTCGACCAGCCCACGGTTTGGCATGAGTTCACGC
CTCTGGCTCTGGAGCATAAAGCTGTGAACTTGGGCCAGGGTTTCCCGGACTGGCGCTGCGAAGATTTTGTCAAGCAGGCGGCCAAGGACGCGCTGGATGC
CGATTTCAACCAGTACGCGCGACCACAGGGCCACAAAAAGCTCGTTGAGGTGTTGGCTAAAAAATACTCGAAGGAATTGAACCGCGAGATCAACTGGACC
AATGAGATTGCTGTTGGTGTTGGCGCCACGGAGACCATCTACGCTGCTGTAAACTCTTTCGTGCAGCCTGGAGACGAGGTGGTCGTGTTTGAGCCAGCAT
TCGATATCTACACCGCCCAGGTGCAGATGGCCGGTGGTGTGTGCCGTTATGTGCCGCTGCACGTGCGCACATGCGACCAGACTGGTGCCAAGGAGTTTTA
CATTGATGAGCCCACGCTGGCGGCAGCGTTCTCGTCGAAAACGCGAGCGGTGCTGTTGAACAACCCACACAACCCGACGGGTAAAGTGTTCACGGAGGAA
GAGCTGGAAATCATTGCCAAGTACGTCCGTCAGTACCCGCGCGTCATCATTATTTCGGACGAAGTGTACGAACACATTCTGTTCGATGGCAAGAAGCATG
TGCGGATCGCCAACATTGACGGCATGTGGGAGCGTACTCTGACGGTCTCGAGTGCAGGCAAGACGTTTTCCGTAACTGGATGGAAGGTGGGTTGGGCCAT
TGGCCCCAGCAATTTGATTAAGGGCATCTACCTTGCAAACAACTGGATCCAATTCAGTGTGGCCACACCTTTTCAGGAGGCTGTCGCCAACATGCTGGAG
CTCGCCGAGAAACCGTACAAAGGATTCCCGACTTTCTATGCCTTCGTCGCCGACCAGTACAAGCAAAAGCGCGATCGTCTCAGCCGCGCGTTGGCTGATG
TTGGTATCATCCCGATCACGCCAGGCGGTGGCATCTTCCTGTATTCGGACATTTCTGCCGTTAAAGTGCCCGAAAGCTTTATTGAGCCGGGTATGTCGTA
CGACTGGGCGTTCTGCCGCTGGCTTACCATCACCAAGGGCGTAACGGCGATTCCAACCTCTGCTTTCTTTTGCGCCGAAAACAAATCAGAGGGCAGCCAG
TGGGCACGTTTTGCGTACTGCAAGACTGACGAAGCCATCGAAGAGGCCATTAAGCGCCTCGTCAAGATCCACGAGCCATAGGAGGCACCAGCGAAGTAGT
GAAGTCGAGCGTGCTACTTGCGTACACTTACTAGCTGGTACCATGCTTGCCACGTTAAAAGGCTGGAGAAAACTGATCGAGTAACCAGATTATCGATCGA
TGCGCGCAACGTGTCAAAACATGAAAGCTGTTGAACTTGCCTATCATTTTGATTGCCATCCAGACTGGATTCCAGTAGCCATGTATAGCAGATCACCCGA
GCTATTTGCAGAGCATCATTCTTTTCATGATTGATTTGCTGCCCGCTTCCTCGTGTCGGTAGCGGCGTTTGCTCTCTCTGCATACAGTACTTATGGCTGC
TTCAACATTTCTCTTAGCGCTGTTAGTTGTGTCCGGTGTTCGAGGCCAGTCAAGCTCATCTTCGTCCAGCTTGAAAGGAGCAGAAGTATCGGTGGTGAAT
ACTACAAACATCACCGACACCTGCAGCCAGGACGAGTACACCAGTGACTGCTGGTATCCTGTGGACTGCAAGATATGCCTCTCACGTACTGGTTGTGCTG
TCGAAGTCTCAACTGGTCGCTGCGTATCGAGCTCCAGTGCATTCGTAACTGAGTCTTCTTCGAGCGAGCTTTCTAATGCACCGTACTTCATCAGCGGGGA
GGTCAAGTACTGCAGCAAAATCGACCCAGCATGTTTCACGTGCCGCCGCGGCAACGCACCTGCAATTTGCTTGGGCTCCTCCGGTTGCGTTTGTGTTTCC
CAATGCGAGCACATCTCGACACAACCCACGAAATGCAAGCCTGGAGCCATCAGTAGCGTGAGCTACGGCGCCCTCATTGCAGCGGCGGCCGTGCTGTTTC
CGCTCGTCATGTACATGCTCGTCAAGGGCAGTAGTATTAGCCGCCTTCTGCGTCGAAAAGAGAAAACTCAACGCAATCTGCCCGGCCGCCTTAAGCTCGA
TGCCTGGCGCAACCACCTCAACGAGCGCGCCGATCCTGTGAACGAGCGCTTTACCGATCTCGAGTTGCGCTCGTGCTTCGTACCCATGGAAAGCGGCAGA
CGTCCGCACCTGCGGGCTGGGGACGACGCTGCAGAGACCGGCGATCACGTTGAAGCTGGTGACAGCGATGTCACGCGGGCCGTCGCTGTCACTGACATGC
CATTCTCGCCGACTGAGGACCGCGCTAGAGAAGAGAAGATCGAGGATCAACCGGGAGCGGAACTAGTGTAGACATACCTAGAGCACACTTGTAGACGTAT
GAGCGCAATGAGCTTTGACCATGGGAAGTGCTGTTGATCGAAGATCATTAGCAGCAGCTGGACAAAACATTTGCCAATTCTCGTTGAAGAAACAATTATT
GCGCACTATTCTGATTATGAATCAGCCCACTCTATGTTAATCCGATTGCGCGTCACTTCAAGGGTATCACAGTTGAGTGGCCTTGTGCTACTTGCCCTTT
CCAATTTATGCCACTAAACTGTTATAGCAATTGTTTAAGTTTGAAAATAGCTGTACAGACTGAAATGCTACATTATTTTGCAGAGTCTAACCGTAATCAG
TATTCGGCGCGTCACGACGATTAGCACCAATCAGATCTACCAGGAGATGGGTACAGCATCCCTTCAAGGTCAGTACTGTACTTTTGGTGATGTACATTTT
TGGGGGAGAAGTTAGAAATCCACCGCACTGAACATGCGGCCAACGTTGACACTTTCCATTTTGAAAGATCGGCGTGAAGGTACGCAAACTTGGTAATACG
GCAATGATCCGCTTCAAGACAACGGCAATACTGGCTGCGCTGGCGCTCGGCTCAGCGCTTGGCGACACGTGCAGCCTGATCAACGACGCCTTCTCCGCAT
GCCAGCTCTCCGCCATGTGCTCTCAGTGCGTCGCGACCTCGGTACGTTCGCTCCTACTTCCCCCCCTCGATATAATGCCATGCAACTAATTTCCTTTCCC
CTTTCACTAACAGGGATGTGAGTACAACCTCATGGACGGCACGTGCACGACCGCGCCAGTTTCCAACTCGTCAGCGGCAACGACATACTGCAGCGCTAGC
GACAGCGTCTGTGCCTCCTGTACTGTTAGCTCCTCCAAGCCGACGTGCACCGGCGAGGACAGCACTTGCATTTGTCCGTCACTTTGTGATATCGTGTCAC
CGGCTTCGTCTTCCGATGAATGTAGTAGTCGCAGCGGCGATACTGCTGCCTCCACAAAAAGCGACAGCCAGGGCTTCGATATGATGTACCTGGCCGTGGC
ATTCGGCGCGCTATGCATCATGGTCATGCTTTACATGCAGCGAAAGTGCGCAGAGAAACGTGGGGAACATCAACTGAGCCTCGTCCGACAAGAATTGGAG
TCGAGGCGGGAGCAACGTCGTCGCGAGCGCGAGATGCTCCGTGCGAGACGCCCCCAGCTGTCACTGAACTTGGAAACGTGGCGCGATAACATCGAGCTGC
ACAAACCACAAATGTCTAAGGTCGAGCTCGAGACGTGCTACTACCTCATGATGCAGGACGACAAGAAAAAAGATGGCAAAAAGAGCAGCGAACAGTGGGA
CAGTGCTTCGGATGGAGATGTGAAGGTTGGAATAGGCGCAACTACGTCTCCAATTGCCAGTGGAGTATCGGATCCAACATCACTTCAGAGTCCTATGCCA
TCGATGGCTCCGTATTTTGCTATGCGTGAGGAGTACCCGAGCAACACAAAGACGGACGGCTCTGACAGCGGTTCCGAAATTGCTTCCATAGCGGACGAGG
ACGAAGAGAAGTATGAGGTTGCCATCGATGTTGATCGTTCCGCTGCCAGGAGATAACTTACTTTACGTTATGGTGTGGTGTAATTCTCAGAAAGTGAGAT
TTTGGTCGAAGTTGCAGCATCAGCTTAACTTGATATGAAAGCAAAATGCTGGGTCACGAGTACTGTGCATTAACTCCGTAGCTTGCGGGTTTTGCTTTGA
CTATAGACACGATACATCCCTCGTCAGGATGACTGAGCCCAATGCTGCAACAGCCGAAGACAGCTTCATCTGATGCCTGATGACGAGCTTTCCGGTGTTG
CAGCGACATAGTGGGCAGCTCCAGCGCAGCTGGAGTACACAGGAAAGCCGCCCTCCGTGGGACCACAAGCTGGCACGAAATCAAAGTTATACTCCCCACC
GGGGAGTCCCCGGCTACGGCTGAGCGCTCGCTCAGCTAACTAAACGACATTCAGCGTCGCTGAGTTGCCGGTTGAGTTAAAGTGGTGTATTAATAACGAT
CAGGTTGACTGAATATGGTCCCAAAAAAATGACTAAATGTTTGATCGGACCAATCTGGTCATTTAAGCAAAGAATGCAGTCGTTTTCCGGATAGCGGGTT
CGCACGCCGAAGGCGACAACAGCATGGATGGCTGCGGCGACGACAGGTTCGAATAAGCCGCTGTGGGATGCTAGATTAGCGATTTTTAACTGATCTCGGG
CATGGCTTGCAGTAACCCTGCCAGTTGGACCTCTGCTTAAATATCAAAGTATGACGTTTTTTTTTGTTTTTTCTTGCCATATCAAATTTATTCATGCTGT
CGCTAGATTTTCTTGCTGTTGCCCCGCGCTTGGTTTCGATTATTAAGCATTCAAGTGCTCTTTGGCGATGAACGTCACGCCCTTTCAAGCCAACCCGATT
TGGTTTGCAATAAAATGACGAAACGGTAGTAATTACTCTTTGTCGGAGCGTATCGTGTATCAATGGAGCCTCTGTCAGCCATGGGTGGCCGCGTAGTGCC
CAAATTGCATTTGATCAACGTTGGCGCCGACTCCGATACCCGCTACTCCAACCACACTCCTAGTGGTGGATCGGTTAGCGAGCGCCTTTCTCATCGACCA
TCTCGACGGCAACCAGAAACACCGACAACGTCGAGGGTGGGGAAGGTCATGCCTACGCGTGTGTCGGGGGCTTCCATGGAGTTCCTGGAGACTGCTGTAC
TCCCACCTATGCAGCTCCGACCAGCAGCAGCCACGCCAAGTACCAGCTCGTCATCATCTCGTCAAGCCAAACAAGCGATAGAAGCCGATTCGACTTCAGG
CAGCAAGAATCATCGAGACAGTGAGGCGGAGTTCCAAGTGCTACACCCAGCAATTGATAAAATGGCAGACGAACGTGGTGAAGACTTGGCGCGTCTCTTG
CTGAGTCGATGGTCGATTCACTCGGGCGAGGAGCAATTCGCTTCGATATCGCTGTTTTGTGAGATGAAGTTGAACGAAGCGAAGCGCATGGCATCGTGGG
CTGAAGCCCCCAATCGATTCTACACCGTTGTGTGCTGCCAGTTACTCGAGAAGTACATTTCACGCATAGCGACGAGTAAAACATCTCACAACAACGTCGA
TCCAGTGGCGGCTACAGTTGGTCAGAGCATCGCGTTCTTACGAAGAATTCACGCCGAGTTGGTTGCGTCGATCTTCTTGCCCCCGACACAAACTCAAGTC
CAAGATCACGCGGTCACAGGGGGTGGACTCGACTACGAACACCGCACACCCTACTTCACGGTACTGCCAATTTTGCATTAACTTCTTTTCTAAATTCCAA
CTTACGTTGATTTCTCGTCCAGGAATTCAAACGTCTTCGCCGTAAAACACAGGCACTAGTTACAACCGTAAGAGAACGCGAGAGTACACGGACGACACGT
CAACAGCTACCCGGTAGAGTCAGCAAGCTCATAACTTATCTGGCCAAGCGACAAGATCGGCAAACTCTTGCTTTAACTTTCCGTGGTTGGGCGAACTCTA
TGGCTGCGCAGCGTCAGATTCGAGCTGTAAGCAATTCTCAGCTTTGGTTGCAATCTGTTCCTTACTTTCACTATATTGCTGTATCCAGCTCAAAATCCAA
GCTTTTCAATGCATGCAAAAGACTAACCTCACCACGTGGTTTCGTGTCTGGCGGATCGAAGCACTAAGGAGAGCGTATCACCGAGAAAGTGCCGACTATC
AAACGATGTTATCTGTCACAGCTGCATCCTTGAGTAGGAAGGATATCGCGATCGCGGAGGCCGAAGCTAAAGTCAAATCTATGGCAAGGATTATCGACAG
CTTAACCGAATCCAACAAGCAGCTTTCGTATCGTGTGGATCACTTAGAAAACCTTTCAGCCGCTGCAGCCTTCGCTAGCGGCGGAGATGGAGGCGCTAAT
AACCACGGCTTAAGTGACAACGACAATGGAAGGCGACACGATAGTGACAACGGCAACTTCTCTCCTGGACGGAGACGCGAGGCAAACTATGAGCGCATCG
ACACTATGCTCAGCCAAGATGATGAACGCATGGATCGCACTAACCGTATGCTATTAGAAACCATGTTCGGAATGGCACGTATGGTTGAAACGTGCGCTAT
TCAAATGTCCAAAGACATGATGGACTCGCTCGAGTACCAACTTGACGGAAGTGTACTTCAGCACCTGGCCGAAATGGTACGTCACAGTGTTTCACTTTAA
GCTTGGCTCTTCAGGTTAAATTGTTGTGGTGATCGTGGATAGATCCAGACAGAGAATGAGCTCAAAGCGAAGGCAGACGCAGCTGAAGGCTCGACGAGCC
TCTCCTCCATACACTTCAGCAAAAGTATCGGTGGCCGCACATTGACAGCATTAACCACGACTCCCTCTCGTGCAGCAGCAGCAAGACCAGCACGTCCCAG
TGCTGTGACTGTCCGCGATCTGGCTCAAATGCCAATCGATACATTGCTGTTATACTGGTTCCGCATGCACTTGAGTTTATCGTCGTCCGTGGAGAAACCT
GCCGATCGAACCGTCAAGAATTTCACATCAGATCTCGCCGATGGTCGACGCATTTC