Description :
From Genome Similarity Track
Location :
Scaffold_272:22043- 25132
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_272-snap-gene-0.11HECT E3 ubiquitin ligase

Sequence
3089 bases(100 bases per row)
AACGAGATGGTAACGCAGATAAGTCTGGTTTCCAAGCAGAGGAAGACGATATAGGTGACGACCAAGTTGAATCATTTGTGGATCAAAGCAGCGGTTCCTG
CTCGTTATTTGGATGCTCGAGGATCGTAGGAGAAGATGCAGGCGGAACAAACCcACCACGAAGTCCAACTCGACCAGATGGGTCACATCAGCATTTCATA
AACGACAAAGAAATGGGACGAAAAATCTTCGGGGAAATGTACTTTCCATTTGAGGACGGTGGCTATGAGTCGAGCAATAGGGATCGGTTTCTTAAACGGT
GGAGAGAAGGTGGCATGCAGTCAACTGCGCCGGCACCTCCTCTCGATCACACTGAAGACGGTGCCACTCATACAGCACCGGAGCAGTCGTCAGCAACCGA
AAGTATTGACCAGTTTACAGCACATGTAGAAGCACTCGATCTTTACGGACTCTTGGAACAATTACACTCCTTAGAGCGGTCGTTCCTGATAATTTCGTCG
CGTGAAGTCGTTGGTAAACTATTGGCTAATACCGCTGCTGCCCCGGTcAACTCATCGGTGGAGGTATTCAAGTCATACGACTTTCCCAACTTTCTCAAGT
TCTCGGTGCTTCGCGGCCAACAGTTCCTTGTCAGCAAAACCGaGCACACAATTAAAACAATTGAGAATCGACCGCCCGAGATGTTCGTGCGTGGTGCATT
GGAGCACGTCCTTCAGACCGCAGATGGAGATACAATTTTGAGGCCTTTGGTCGAGTATTCACTTCATCAGATTGAAAATGCTGCGACGAATGGCGAGTAC
GAGACTTACTTGTGGACGCAACGAGAGCTTACTCGTGCAGACTCTATCGTCGCTAAGGAGCCAGCTGTCGAATTGGCAGTTTGGATTCTTGACATTGTTC
TTCGATCTTCAACATATCGGCGCTTCGCTTCTAGCGACTATGTGGACGAGATCCTTCGGCGTCTACGGTACGTCTTACGGTCAAGTAATCTACCACTCAA
ATATCTTGCGATAACGACAATGAGTCGGATTTTGAAGCCTCTTTGTCGACGGTTGAAGCAGGAAAGTGAATGCAAAACACTCGAATGCGTCGTTGAAACA
TGTCGTTTGGATTTCGAAGGCTTTTTGTACGCTGCTCGCAATCGATTTCAGCGTGAACAAGTGCAACACCGAGCGGTTTTCtCCTTGTATCTACAGGCGT
ATTTGGAGATTCTACTCGTGCTCCAAGCATATGATAACCGAGCGAGCTGCATCAAAGTTGAATCTCTGCCTCCTCCTATTGCAGCATCGTGTGTTGCGTC
ACCTCTTCGCGATTCAAATGGCCATACTTCGCATCCGCGTCTAGTGTTTGACCGTAAGAAATGCCGAAGTAGCCTTCTTCAAATCGCGGATGACGGTTTG
AGTGTTGCATATACTGGGAATGAAATGTGGAAGACCGTCGTGACGACACAAAGCTTCTCAACAGGTGTACATGAATGGCAAGTTCGAGTCGAGAAGTCGA
CGTCGTCGTATTtGTtCATTGGAGTGGCCACACGACGTGCGAATCTCGATTCGTTCCTTGGTtCTGATGATCAATCCTGGGgATTCATTGGAGACAAGGC
GTTGTACTACCAAaGAAATCGCCTTCGAGTCTATGGCGAGGCATTCACTGAAGGCGATTGCGTTGGTGTCCACCTCAACTGCGAGCTTGGGACACTTTCC
TTTAGTAAGAACGGATCTTCATTGGGTGTCGCTTTTGAGAATGTCCAGGACGAGGTGTTTCCAGCTGTCGCGTTCTACTCGCGACATCAAAAAGTCTCAA
TCGTGGCCCCCGAGTCCAGTGGAGACATCCCAAGCAGATGTGGTGATGGTGGGTCAGGCTCAAGTGGCGGGACTATCGAAGAAGCCGTGATTGTGTGTGA
CATGATGGAGCGTATGAGCACCAACACGACACTTCGCCCGGAACTGCTACGGGCCGCATACGAGATGACGAGAAACTGGCTGAGTGGTTCAGGTAGACAT
GTCGTGACGCGATCAGGCAGGGCACTGTGGGTGGATGTAACAAAACAAGCCTGCCAACCGTTTGGATTCTTTGCAAATGATCGAGTGCGAACCCCTCGTG
GTAACGGGCGAGTCTTGGGCgTCGCTGACAACCGCTTGTGGATCGAAGTGGACGGAGAGACAGGAGCGTGGCACATGCATCCTTCTCGGCTGCGGTCAAT
GGCGTTGAAGGTGAAACCATCTGTGGGTGTGGAGGTTAAAGAGACCACGTCTGAATCGGAGGACCTAGCAGCTGCCTCGATAGATCAcACAATCATCAAC
TGCAAGGGTGTGGACGCCGATAGATGGAGCGAAGACGAGTTTAGAACTCTAGTTCACGACAAGATGTGGTCACTCCGTTTGGATCGAGTCATACTCGGCC
TCGTCAACAGCCACTGTGATACGACAAGCATGAGTCCATGGAACATACTACCCAGTGACCTCACCCGAATGGTGCTCGCAAAAGCACAGGATCTGGAGCA
GGCGGCTGGAACTTCACTTGGCCTTGACGTGGAAAGCACGAAGGCCGCATTCACACGAAGCTTGTTGGCTCGCTTCGGGTTTCTGCGTTATTTCAATGCG
TACTTCTCGCGAGTCGTtCCCTTTTTCGATATGACGTGGCATTATTTCTGTCCAGAGACCGCTCTTGAGCCATGTCGACTGCTCTCTATGTGCCGAGGAA
GCATTTTTACATCAGTCAAGAACGATGTTTTCAAATCTTTGCTAGATAAGACAGCAAACGCTCCGAAAAAaGCTGATGATGACTACGACTACCCAGATGA
TCTCACTGTTATGCTGATCAATCGACCGAAGGCGGCGACGGCGAAGTGTCACCCTGGCACAACTAAGAGCTTACTATTATCAATGTTTGGACAGTCCTTT
GAAGAGCTGCATTTCCTACCATTACGTGCTTTACGAATGGTGTACTCGCATCCAATGGACGATGGCCAGTTGAGAAGCTTCAAAGTCAAATTTGAAGGTG
AAGGGGTTGACGATTACGGGGGTCCATATCGCGAGTTCTTTTCACAGTTCTTCACCGAGTTGCAGATGGTAGTTAACGATGGTGAGGCT