Description :
From Genome Similarity Track
Location :
Scaffold_23:22043- 24891
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10731hypothetical protein
Phypa_INRA-310PPTG_10732hypothetical protein

Sequence
2848 bases(100 bases per row)
GCCGTGAGATGAGCGCCATCATGTCTCCTTCGGCTGCCGCAACAGCTTCGAGCGCCTCGTAGTCATGCGGCCCACGTTTGGCCACCAGACCGCCAGCTAC
GAGCACGGCACTTACATCGCAGTCCTCGGAGCTCACCAGTTCCTCGCACAGTTGATTAACACGCGGGATCTGCCCCTCCAGGTCGCTCAGCAGCAACAGC
TTCAGCTTAGTGGCGTCGGTGCGAATCGTCATAGACGTTGGTTTGTCTCGATTGGCAGCACTCCTTGGCGCAACGTTCGAGCAACATAAGCAACGTGGGA
CCTAGGTGTATATCGGTGCCGATCCACAGACGATGCCACGATGAGTAAGTTCTTGCTTGGGCTATGCTCAGCGGACACACAGGAATCTTGTGGTATTGGC
ATCATCGCTGGCGAAAGGCTCGTGAGAGGCATTTATTTCATCTTGTGGACTGAAAATCGTTTGGCGTCAAGTCGAGTGGGACGTATACAGTCACCTCCAT
CGAAATAGTCCCCACTCCATATTCTACTTGGGACGGTGTTCTGTCGCCAGCGTTATTCAAGCTGCCTCGATGAGGTGGATAGCATGTAAATGTGGGCAAA
CTATTGGAGCTGAACCGCCGTTGAACCGAAACGAAAGGTGGTTTTGCGTGGGAGAAGCATCAGTCAGCCAGGCACATCTCTGGCAAGCGCGGCATCACAC
CAGCGAACTGCTTCTTCCCATTGCAGACACTCGTCAGAAACCACCCCCAACTGCTGCAACTTGAACGGTGTGGCCATGAGCGTTCATCCCCGTTTTTTGC
TGTGTGAACTCGCGTCACGGCTATTTTCCGTTGAAGCGACAAACGTTCGGACGGCACCACCGTATACCGGATAAAGCAACTTTGCCGCCGTTCCTGTACT
TACTTTTTGTAAGTCGAATTCAAAATCATGCCGGTAAATGTTCTTGCTACTTTCGAGTATACATTGTCGACCGTTAGTGCTCGGGTTGCGGCTTCGCCAT
GGGATGGGGAGGGCAGAACCGGGAAGACGCCCCCACGCGCTCCATTCCTGGGGATCCATTGCTCACTTCTTCACTTGTCTTCGCCCCAAGTCCTGTTCCT
CTTGTTGGCGGGCCTCCACCGGCCATGAACGCAGCGCATTACCTGCTGGACCGCATGCGAACGTGCAAAGCGTTGCAAGAGATTGGTGACAAGAAAGCGC
GCGGCTGCTTCTCGTCCGTGGGTAGCGCTACGCATTCGTTCCACGGCGACGATGCTGTGGGCTTTGGACCAGGCTACATGGTGGTGGCGGACGGAGTGTC
GGGAACCATGAAGGCGTCAGGTGTTCTTGCACGCATGCTGGTGGCCGAAACGCTGTCGGCACTGGCCAAGCTGCGCAAGCGCTCGCGGGAGGAACCCCCG
TGCGCCGAAGACTTTAACGAAAGCATACAGGCGGCCATCAAAAGCGCACGCAAAATGGCCAAGCGCAAAGGACGACTCGACTCGACCATCTCAGCGGTCT
ACTTCGATGAGACCACTCGCCAGATGTTCGTATACACGATCGGCGACTGCAAGTGCGTAGTGTTCCGCGGCGCTCAGCTCGTGTTCGAGAGTGACTCCAT
CATCTACGACTTTAATGTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN