Description :
From Genome Similarity Track
Location :
Scaffold_36:220426- 223276
Sequence
2850 bases(100 bases per row)
GGGCTTGAACTCTCGTTGCGAGCCCCGCCAGACTTGGCAGGTGTAACTGGTACCGTCGGTTGTCCTTTCGCCATGTTTCTTGTTTTCTTTTTCTTGTTCT
TCTTCTCTTGGTAGCTCGTAAACTGAAAGGTCATACAAACAGTTCACAATGGTCACAATCTGTTCCCGGGTCGCGGCACCAGTTGTGGTGTTGGAATTCC
CCCGTGAACTCTAGCTACAAATGTAGCTAGGACGTTCCCACAACAATACGTCTTCTAGGATAGTAAACGATCGTTCGGGCGGACCTGACCACCCCAGTTC
TGCCCTTGCACCGGGACAAACTGGACCTTGTAAACTACTTATATAGGCCAACCAGTAAAAATAAGAACACGCTACTAGCACGAGCAAAGCTAGCAGGTGT
TTTGAATCCTCATGGTCCCAACAGCGGAAGGGTACCAGGCACAGGAAAGCCTTTTACGAGATCACCGAGTGTTCAACACTCGGTTGGAGGAATAAAAGGG
AGGCAATTCAAGCACTCCCAGTCGTGCGAATAGGCAACAATAAGCCGTCACGTAAAAACCTCCCGATAGTAATCGGCCAATACACAAAGTCTCTTGGCCT
TGCCGGATGAACCCTCGCTACAGAGCTTCGAGTTCACCGACAGGCATAACACACTCAAACAAGCTTGACCAGACGCTTGCCTTGAAGCCGGACGTCGCTC
TGTGTGCTTGAGTGGAAATTCTGTTCTGTATTTAAGCTTACCCGTTCGGGTCTATTCCTAATAAGAAGTCCTAATCAAGTATACAAATACCAAGTGAACA
ATGATCCGTTATGGATCTTCTTGCACGCCAAGCGTCGTCTGCATCGTCGCATGAGTATCTTTAACGGTCCGCGCCCTGTCCCAGACGGTGAACGTGCCTT
CCAAGGGTCGCGTAACGGTCCGCGCCCTGTCCCAGACGGTGAACGTGCCTTCCAAGGGTCGCTGAGTCTTCCGCGAACTCATCCCAACCGCCACTGAGGG
TTCGTACCGTAGATGGTCCGCTAAATGCGAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGGATTCAGTGACATATGGCCGTATCCAATACTCG
TTGAAAGTTCGGAAGTGACGCCGTCGAGTCCCTTGCACCTTGGCGTCTCCGTACATCACATGACCGAGGGTTTGTCTCTTGAGCATCCTGGGCGGTGTCA
CGTCTTTGTCGACGGATGATAATCCGCAACTACGGAGAAATCACTACACCACATACGCCTCTCTTCGATATGTCCTTAACGTCAACGACGGCTTTGAAGA
TGACATTGATGATCATGTCGAGCTTCAGCTCGAGGGATTGTCTTGCTCTCGGTATGCGTTCCGCGGAGAGATCTATCGCAAGCGCAAAGACAAGTGGACT
GCGTATTTAGATGATCATTGTGAATTGAATGACGAAGAGTTCTTGGGACAGTTTCGCGTTAGCCGCAGCGCTTTCGGCGCTTTGTTGGAACTAATACGTA
CTGATCCAGCTTTCAAGCCGTCTGGTCGTCGTGCATTTCGTGCGGGGGGGGGGTTACATCTTTTGATTTTACTGAAATTCTTGGGAAGTTATGGAAATGG
GAATTCGTCGCACAAGTTAGCGCTGTTCTTTGGTGTCGAGAAAGGTTCCATAAAGAACTATGTGAGACGTGCCAGCCGGGCTTTTTTAAAGCTACAAGAC
AGTACGATTACATGGCCAGATAGTGATGAACGAGAGCTAATAGCCGCACGTATTCAGGACAAGTACCAGTTTGTAATTTGCGTTGGTCTCGTGGACGGAA
CCTTACTACCACTGGAGTTCAAGCCCCGTTGTAACGGTGAAGACTACTTTTCCAGGAAAGGTGGCTATTCTCTCAATGCACTCGTGATTTGTAATGATGT
TGCTCGTATTCGAGAATTTGTTGTTGGTTGGCCTGGAAGTGTGCACGACAACAGAGTGTGGTCTACTAGTAGCATTTGTAGATCGCCCGAGATATTTTTC
GGCCAGAACCAATACTTATTGGGTGACTCGGCTTTTCAGCCTTCACAAGTGATGGTTGCAGCGTTTAAAAAGCCTCCTAAATGCGACCTTGATATCCATC
ACAAGTACTTCAATACCCAATTGGCGAAGGCACGAATTAAGACTGAACATTGCATCGGCTTAGTGAAAACTAGATTTCAATATCTTCGTGGGATTCGTAT
CAGACTTTCGGGGAAAAAGAGTATGCGACGGCTGCTTCGCCTGATAGCATGCGCATTTATCCTGCACAACCTATTGATAAGTGAACCTATACCAGATCAG
TGGATGAAAGACTTAAAGAAGTACGGAAATGGATTAGATGCTGATGATGAGCTGAATCTACCAATTTGCCAAAACTCACAAGGTGACAAGCGAAGAAAGC
AGTTATTCCACTATCTTCTGGAGATCCGACGGTAGAAGCATGTCGGTTTCACGTTGTGGAACCCCGTCTTGGAGAAGTCTAAGGCGTTCTCGAAGTAGTT
TTATTTTGCACTCCACCTCGCACGATTCTGCTTGGGCACGGAAGTGTAGCGTTCGAGCGGTCGCCTCAACTACTCTAGCGTCGATTTCTCTGTTGGCTTG
TGCAACCTTCTCACGTTTTAGATTAAGAGACTGCAGCTGGAAGTCTTTTTCTTGGGCAAGCTGTTTCTTCTTCAAGTCCACAAACGAATAGTTAGCTGTA
AGTTCGTCCACAGTATCCTTAACTTTCTTTCTAATAGAGCCAATTGAGCGAGGCCTACTAGAAGAAGTGCGTTTGTGGCCGATGGTAGTATCATTTTCAG
GTGTGGCAATAGTCAAAGTCGTTTTAGTGGCAGCGCTGAACAGCTTGGAT