Description :
From Genome Similarity Track
Location :
contig_1:220366- 221599
Transcript NameFunction/comments
g54.t1Nucleolar protein NOP5

Sequence
1233 bases(100 bases per row)
CATGCCTTGATGCGTCTATTCCTCAGCGCTCTTTTTCTTCTTGTGCTTTTTCTTCTTGTCCTTCTTGTCATCGTCGGCTTCGGCAGACTTTTTCTTCTTG
TGCTTCTTCTCCTTCTTTTCCTTCTTGACCTTAGGCTCTTCCTCCTCGTCGGTCTCCTCGGCCTTGCGCTTCTTGCTCGACACAGTCATGTCGGCCTCAG
CGTTGTACGTCGTGCTGGTCTCCGTCTTCGTGTACTTCTTGGCCTCGTTCTTGGTCTTGCCGTTGCTATTCGGCACGCCCGAGAAGCCGTTCTCCAGCTG
CCGCACGCGGGCCTCCACCTTGGCGCGGTTGTCGAAACCAATGGTAGCCTCCGTGGCGTCGCCCAGAGCGTCCACACGCACAGCCAGCGCCGTCTTGGCC
GCCAGCACACGTGAGATCTTACCCTTGTGCTTGGGGGCAGTTTGGCCGATCAGCGAAGCGTGGTAGATCAGACCGTACTTGGGGGTATCGTGCTTGTCTT
GAGAGCACGGAACAGAGCCTTCTCGGCACCAAGGATCTGCACGGTGGAAGCCGGGTGCTTGGCCAAGTTCATCAGACTGCCAGCGTGGGCAATGAGACGG
GCACCCACCAGCTCGCCGACCATGACGGTGAGATTGGGGGCAATGGCGTTCATGCGGTTCTTCAGGTAGTCGAAGAGCTGGGCGCGGTACTCCGTGAGGG
AGATCACCTGCTCGCACAGAGCCGAGATGTTGGTCACGTCCTCCTCGGAGATGTCCGTGCCCATGGAGACCTCGCACACCTCGCGCATGGAGGCCTCGAC
GTCCTCCGACAGGATGTCCGAGAAGTCGAGCTTCTTGACGTTCGAGCGCACGCCCATCTTGAGCACGCACTTGGCGTACTGCAGGTTGTCCGTGACGATC
TTGCCCATCTCAGGGAAGTGCCAGCCGAACCACTCGCGCACACGCATCGAGTAAGTGTTGATCTCCTTGTCAAGCTCGTCGAGCAGCCCGATGGCCTGCA
CGATCATCGTGTCCACCTTGTCGGCGCTGAACTTGAGTTTGTAGCGCGAGAGCGAGTGCGACAGACCGAGCGTCATGGCCTTGAGGTCGTCGTCCTCCAG
GCCCGTGATGAGCGTGTCCATGTTGGCGCGGATGCCACGCATCACCTCGTTCACGGCGCTGTCGTTCACGCACGCGATGCTGAGCTTCTCCTTGATGAGG
CTGCCGAGCGCCTTGTCCGAAACGGCCAGCTTG