Description :
From Genome Similarity Track
Location :
Scaffold_344:22020- 25135
Transcript NameFunction/comments
Phyag_g4864hypothetical protein PHYSODRAFT_478276

Sequence
3115 bases(100 bases per row)
AAAACGCTATGGCCACTGCATCTGGGAGGTTCCGCAAAGTCCACCTCAATAatgacgaggagaacgaaaGACTGCGACGCGAAGAGAAATACGCAAACAA
TTACGTGACCACGTCCAAGTACACAGTCGTGAGCTTCGTGCCCAAGATGCTCTTCGAGTTTTTCCGCGTTATCGCCAACTGCTATTTCCTGGTGATATCA
ATTCTTCAAGTGGCTACGACGTGGTCTCCGACGAACAAGTACACGACAGCAGGACCTTTAGTGATAGTCTTGATGGTCTCCATGATCAAGCAGGGGATCG
AGGACAAAAAGCGTCACGATGCTGACAATGTCCAAAACTCAAGACATTGTAAAGTTTTGGGACGACAGGGAGGAGTTGTGACGAAGGAGTGGCAAGAAGT
GGTCGTAGGGGATATTTTGCGTCTCGGGGATCGAGACGAAGCGCCTGCGGATGTATTCATTCTCTCCAcatctgaagaagaaggtcgaTGCTTTGTCGAA
ACATGTAATTTGGACGGCGAAACCAATTTGAAGCGGCGAACCGCCATCGAGCAAGTAGCACACCATGTTGGATACAGGAAGTTGAACGATCCAGTGTTAC
CAGAAGGCGATCACAGCAAGCAAACGATGAAGTTCAATGGTACAATAGAGTATGAACAGCCCAACAACCGACTGTACAACTTCACGGGCAGGATTGAATT
TGGTCCTAACAAGGAAGCTGCCCCAATTGGCCCGTCCAACATCATTCTACGCGGTTGTAGCGTTCGCGGATGTGCGTACATTTACGGGATCGCCATTTTT
ACGGGCTCCGAGACGAAGTTAATGCAGAACGCACGCGCAACGCCATCGAAGCAGAGCAATGTGTACAAAGTGGTAAATCGCTGCATCCTACTGATCTTCA
TCACGCAATTTGCGCTTTGTATCATCAGCACAATCTGCAACACGATCTGGATGGACAGGTACCAGAAGAAACTCTGGTACTTCAGCACGGCCTTTGCAGG
AACCTCATCGGGCTCAAACCTTGTGAGTTTCTTCACATTCCTCATTCTGTACAACAATTTGGTGCCTATTTCGTTGTACGTCTCGCTAGATATGGTGAAA
GTCATCCAGGCGAAAAACATTTCCACGGACCCTGAAATGTGCTACGATGGAACGTACGCGCTTGCGAGAACCTCGGACCTGAATGAAGAGTTGGGGCAAG
TGCACCACATCTTCAGCGACAAAACAGGCACGCTCACTTGTAACATCATGGAATTTCGGAAGTGCTTCATTGCTGGTGTTTCCTATGGCTTCGGTACAAC
TGAGATTGGTCGCGCTGTGGCTGAGTTGGCAAAGAagaatgctgctgccaatggGATATCGGTTGATACAGGTAATAAAGGAGACGATGAGAAGCATCAC
GACCCACGCGACGCTCAGGTTGACTTCAACCCCCTCATTCATTTCGACGACCCGCGGTTAGTCAATTCGTTAGCTGCGAATGCCCCAGAAGCTACAGCTA
TTGATGAATTCCTAACGGTGCTTTCCGTATGCCATACGGTCATTCCCGAAAAAAACGCGAAAACCGGTCAAGTCGATTACCGTGCTTCCTCtcctgatga
agaagctttGGTGAAGGCTGCCAAGTGCTTAGGATATGACTTTACCACGCCAGCTCCACTCTTGGAAGTCAAGGTGACAATGAAGAATGGACCATCAACT
GTACGGAAGTACACCATCCTCAATGTGAACGAGTTTAACAGCACGAGAAAGCGAATGTCGGTGACAGTTCGAACTGAGGACGGTCGCTATTTTCTCTATT
GCAAGGGGGCTGATAATGTCATGATGCCTCGCAGTAAGATCGACAAGCACACGGTAAAAATGGACGAGGAATTGAAGCGGTTTGCAAGTGAAGGACTTCG
AACGTTGGTGCTAAGCAGCAAAGAGCTGACGGAGGAAGAGTACTTGGCTTGGGATGTCAAATATCAAGAAGCTGTGACGTCATTGACGAATCGCGATGAA
CTTCTGGAGCAAGTAGCCGAGGTAATCGAGACCGAAATGAAGATCGTGGGAGCGACAGCAATCGAAGACAAACTGCAGAACGGCGTGCCGGCTGCAATTG
CGAACCTCGCTCAAGCAGGAATAAAGATCTGGATGCTGACAGGCGACAAAGAGGAAACTGCGATTAACATCGGGCATGCTTGCCAATTGATCAATGAAGG
CATGAAACTCCTCATCGTCAACTGCGAGGATCTGGACGACTTGGGTAGACAAGTTGACAAGATCTACAAACTGGAAGATGTGCAGTCACATATAGACTCC
AACAAAGTGTCCAGCCATCTTGCACTAGTCTGCGACGGCAAAGCGATGGTACACGTGTTCCCGCCGAAAAATACGACATCAGAGCGGGCTCTACATGCGG
CAAAGGTGCTTTCGCAAATGATCTTAGACATATCCAGCGTTTGCCAGGCAGTCATTGCATGCCGAGTCTCTCCTGCTCAGAAGGCAGATATCGTCAACCT
CATTCGGTATAACTCGCCGCATAAACCAATTACGTTAGCTATTGGCGACGGAGCCAACGATGTGAATATGATTCAGTCAGCTCACGTGGGTATCGGCGTg
tcaggccaagaaggcgtcCAAGCTGTAAATGCCAGTGACTACGCAATCGCACAATTCAGGTTTCTCGAGCGGCTTCTTTTAGTTCACGGCCGCTTCAACT
ACCAGCGGATCTCCAAAGTCATTCTCTATTCGTTCTATAAGAACGTGGCGCTCGTCATCGCGCTGTTCCTCTTTAATTTTTACAACGGACAGTCAGGTAC
AAGCGTGTTCGAGAGTTTTGTCATGGCTGGCTGGAACTTCTTCCTGGCGTTGCCAATCATCGCGATCGGCGTTTTTGATGAAGATGTCGCCCCCGACCAA
GTTCTTCGCAACCCAGCGCTATATTTTCCTGGACAGAGGAACGATGGAATTAACATGATTCGATTTTCGACGTGGATCATCAATGGCATCATCCAAGCGG
TCATCTGCTTCATGCTGGCAATGTATGGCACAGTCAACGTCGGTGGGCTCAGTGTGGGGCTGTATTTGCAAGGAAGCGTCATCTACTCGGTATTACTGAT
GTCCGCCAACCTGAA