Description :
From Genome Similarity Track
Location :
Scaffold_57:220194- 222434
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16443DNA replication licensing factor MCM5

Sequence
2240 bases(100 bases per row)
GTTAAAGTTAACTACTTAACGCGAGATACAAACTTGTACTGGCTGAGCTGTCGAAGTGACCCTTTCTGCACCATGGCTCGGATAGCGCGTTGAATAGCGT
TGGGATTGTATCCCTGCGCCTCGAGACGGCTGTACAAAGCGCTGGTTTCGACACGAGTACCAATGCGTAAAGTGCGGTTAATACTCTGTTCCACCTCCTG
CGCTTTTTCATGAAAGCCACCGAATAGTCCCTGAGTACCGCCGTCTTTGGCTGCGTTCATGGTACTCACACTGAACAATCGAATGGCTTCCTGCACATGT
TCACGTGTGGCTTCGTTAAGCAAGTGCATTTTTGCCAATGATTCCGCAATACGCACAAGAGCTTCCAGTTGACGCACAGTGACGGGAATGGTAGTTTCCC
CGCCCTGTGTACGACGCACATCGTCACGTACACCAACGTAAAAGTCCTGAAGCGCTTGAGCTGCGCCAACCGACAGTCTCGGGGCGCATCGAGTACGACA
ATAAGTGATGAATTTCTTAAGCAACCAAGGCTCAAATTCTCCCCCACTCGAGGCATTTTCACTTGCCGAGGGCTTTCCAGCTGCCGACGCTAGTGCATTC
GTGTGCATTCTCACCACGTGAGCAGCCATTTGTCTGTCTCGAGCGTCGTCCTGGATATCGCGGACGATGAAGATCATGTCGAAACGACTGAGAATTGTAC
TCATCAGGTCGATATTCTCCGATGCAGAGCGCATATCATCGTACCGACCGAATACAGGGTTTGCCGCTGCTAGTACACTTGCACGGGAGTTTAGAATCGT
CGTGATACCAGCTTTAGCAATAGAAATTGTCTGTTGCTCCATGGCTTCGTGAATTGCCACGCGATCTGATTCGCGCATCTTATCGAACTCGTCGATACAC
ACCACGCCACCATCAGCCAGTACCATGGCGCCGCCTTCAAGGTAGAATTCTCCCTTGGAGTCACGGATAACTGACGCCGTCAGACCAGCTGCACTACTGC
CTTTACCCGACGTGTACACCCCCACAGGGGCAATTTTTTCCGTAAACTTGAGAAACTGCGACTTTGCCGTACTGGGATCTCCCAAAAGCAACACATTGAT
GTCGCCACGCAAGATCATGCCATCTGGCAACCTTTTCCTCGACCCGCCAGCCAGCAAACACGCAATTGCCTTTTTGATGTTCACCGTGTAGTCGCCATAA
ATCGAAGGGGCAATACTCGTCGCCAGCTTCTCGTACAATTTCGGGTCTCGCGCCATTTCATGAAACTTTTCCTCCTCAGCTGGGGAAAATGTTGCTTTGG
CACGTCCTGCGCCTTCTTCGTCGATCTCAATGCCCACTACGCGCAGATAGAGTGTGCGGATGGCTACAGCGCCGACGTTTTTGCCTCCTGCGTTGACCAC
AGAGGTAATGCCGACCACCGAAACTCGCGTGCCGGGGGACGCTCTGTCCACTAAGTGACGGTCGGCAACCAGCGCTAAGTTTCGGGGCATTTCGCCAGTA
GGTACAACTTCGGGGTTTTCTTGCAGTTTCAGTGTCTGTTGGTCAACGTAGTGGCCTTGATCGGGCAACACAACATACGAGTCTTTGGGGCACATTTCCC
CCGGGGTTACTCCATTGTCTTCCTCGCGGTTGCGGTCACAGATGCGGGGGATGCTCACGCCTCCCATTCCGGCAACGGCAACTCGCTTGGTGTGGCCACA
GTTACGACATTTCAAAGTTGCCGACACGCACTTCGTCCGCACACGCGTGGCGCTGATTACGATGCCTGGCACTTTCACCAGTCGGTTGATCTCCTGTGAG
TGTACGTGGCGAAGCGCCACTGGGGCTTGATCACTGGTTAGAATGGCCTGGATATCTGGCAAGTTGCTTGAGGAAATGCCAGAAGTTGACGAGTCTGGCG
CACCCGCGTCTTGGCTGGACACGAGCAACTGCGTCAACATTTCCTTGGCTGCGTTCTCCAATAGAGGGAGTTGCTCCTTTGGGCTCTTGAGAAGCAGATC
TTGTAGTTCCTGATCGAAGGCTGCAACGTGTGAGAGGTTCACGGTAACAAACCAGTGGCTGCGCCGTGCGTTGGCGAGGAGCTGCTCGCGGTAGTAGAAC
AGCGGACCCACGCGAAACCCGCGCAGGAAGGCTAGTAGGCGGCGCTGTAGTGCTGCTGGGCTGGCTCCCTGGCGCGCGTCCGACGCCTGGGCGCTCTCCA
TGCCCACGGCAGACACACGACCGGCATCCCAGTCCATAGT