Description :
From Genome Similarity Track
Location :
Scaffold_334:22017- 24719
Transcript NameFunction/comments
Phypl_g7100hypothetical protein PHYSODRAFT_286381

Sequence
2702 bases(100 bases per row)
ACTTACCAGCGCCGTAAGAACCAGAGCGCAAAATCCGATTTACCGGTGCTCCTATTGACTTGGCTTTTGTAAGGGTTAAAGACGAGCCAACAGCGGAACG
CGCCCAAAATTCTGTTTATGACGAGCCCGAAATAATAGAATAGCCCCGCCTCCAAATTGCTGGCGAAAAACTTTGATGGCACGGGCTTCGGCTGCGCAGG
ATGCCGAGCGCGATAAGGCTGTTGGCCCGCGGGCTCGCGGCCGTCCGAGCCAGCGATTATGGGTCCATTGCCCTCCGCGACACGCTCTGCGATAACGAAG
CATCGCACGATACGAAGGCTGTCTCGAAAGGAtgcgaagctgcagcgtgtgttttggcagcttcaacctcCCTGCGGGGATCATCGCTCGCCATCTAAGT
TGCGTTGCGCTCGCCGGATTCAGGCAGGCAATTGCAGTTTGCACTTCGGTGAGTGTGTAACTCTGCGTTAAtccaaggtggcgctgccaGTGATCGCAAG
GTCGGCGTGTCCGTCCTGCGCTCGGCTCGGAGCGGGCCCGTCGTTTTCGCCGCTGCGGCCAGCGCCCGCCGGACTTCTGCACTCGACGACAACTGTCCTC
CACGACAGGGCACTGCTGTCAGCGGCGAAAGCGGAAAGCGGTGGCGGGGCGGCGCCATCGCGAGCAGAGCGGCATCTCCCCAAAAAGTGCGAATGGCGGT
AGGTCGCAGCGCCGGGCTGCAAAGGGAATGTTTACTGACCAGAGAGCCTGTACCGCCACGGATGGGACGTGCCGACCTCCAACGTGGTTGTACAGTACCG
AGAtcgccgctgcgctcgctgtcaTTCTCAAATTCGCCTCTCATCGAGCGAGTGGCAGTGCCAAGTCTCCAAGCCTACAAGCAATCCGTCGCAATCGCCG
ACACCACCACCGACCAGCATATTTTCCAGCGTATCTAGCTCATCATGCAcatggttgctgctgccggatCAAGCTCGCCCATGTCGGCctccaagcccaa
gcccaagtCCATGTCGCCGACGGCCAAGGGCATCTGGTCCCAGGAGGAGCACGACCGCTTCCTGGGGGCCATGAAGCTCTACCCCAAGGGACCGTGGAAG
ACCATCGCCGACCACATCGCCACGCGATCGGTGCGGCAGGTGCAGACCCACGCGCAGAAGTACCAAGAGAAGGTGTCGCGTCGATTGCGCGGTCTGCGCA
AatccaagaagaaactcgTGCGCCCGGAGCACCGCATCGATGAGGACACGATGGAGCTGTGCAAGCTGGTCGACTgcgccgccgagaagctgGTCGCAGC
GAGCAGGAAGTCATCTTCGCGAGCTAGCGGCATCAGGCTAgagccgctgcagaagaagaacatcggtgtgaagcaggaggctgCCGAGGCCCACAGCAGC
CCGCGCGGCACAGATGTGGAGATGAAGACCGACGACTTCTTGCCGTTGCCATTCCTGGACTTtggcgacgacatcgacctGGACCCCGTCCACATCCCTA
CCGTGAGCGAGTCACTAGACTTCCTGATCGACTACCTGTCGATATAATTCCTGCTGTTAGTGCAGTAGCGACGGGATAGACCCGTCATATTTGGTGAGGT
ATCCGTGATCAAGCACACCTCCGCTGCTGGGGTTGGCTTCATATATTTATATCATAAAGAGCCTTATGCAATACAAGCCTTTGACGGTGGGGACTGATGA
TGGTGCGTCGACGGACAGCTACGCAGATCCACCCAGCGGGCTGGAGTTCAAGTCACTACCCGACTCAAGCAGCCCCCGCTTGATActtcagcgacggcgt
ctccCACCCGCGGACCACCGTGTCACttgcttgcagtgctgccGAGATGAGGAGGCCTCGCGTGCGGGTCCAGCGCTCTCCTCGTCAtactcgagctcgt
gcgccagGAATCACTGGCGTGGTGAAGTGCCACCACTGTCATGGCGCTACGACGCGCAAAGACAAAACACTCTTCGCTTTGGCAGCCGACCAAAGCGTGC
TCGAGGAGAACGATCATGTTGCTATCTAGCGCGCAGGCAGACACAATGAGGCAATTTGGCGCTGGAGCCTTTGCAGCACTCGCGTCGCCTTCTTGATCAC
GCTTGATGAGCAACGCGCGGTAACACTTCAATATCGACCGACTGCGGCAAGCACACCGTAAGGattgctacatgtactgctATCGCTGCCGAGGACTCCC
TCGTCCCCAGAGCACTCCGACCGACGGTCATCGCCACTGGTTCGGAGCGCAGCGATGGTGATCACCAAGATTAGGCTGGAGCATCCAATCTTTGTGCTTA
CGACTGAAACGTGCTGTGAAGTTCACAGTGTGAACGACGGCCCATAACGCGCGTACCGTGGCGCAGCCATGTCGCATGCGCACAGGATTCGCGGCTTGCC
gtgcttgcttgcttggcCGCTTCGACTTCGGCGCCACCGGTGCTTTCAACAATTAACTTAGGAGTACAGCGCTGGTTTGAAGAGTGTTGGAGGTGGTCAT
CCATTGCGGTTGCAGATCTCGACATGAGCGAGTACGACCGGGTTGCCAGCGCGTGTCCACCCGTTGAGCGCCGTCAATCTCCCGTGTCGAGCGAGACAAA
TCGCCGCGAACGAATTGCTGCACGCAGCAGTtccttcgcagcagcgttgaAGCTCCTGGAGATTCAACTCGCGCGGCGCGTCTACGGATCGCCTTCAACT
CG