Description :
From Genome Similarity Track
Location :
Scaffold_218:22015- 23231
Transcript NameFunction/comments
Hyaar_Emoy2812794E3 ubiquitin-protein ligase UBR1

Sequence
1216 bases(100 bases per row)
TCATTCCAGTATTTAGCGCTGCTGATCTGTTATAGCGTCTGCATACCAAAAAATTTTCAGCCTGGGAAGCTCGAGGGAGTATTGCTGGTTGAAGACAAAT
CGTCTGCCGACGCAACGAACGAAACTGCAGAGCTAGAGCACATGGTAGCTACAGCTGCGGCAGCGGCTAGCAACTCTGCCTTGGCTCCGCGTCGCACTCG
AAGTGGCCGTGCTGTCGGCTGTGCCGCGAGTACTCGACCTGCTGAGGCTCCCACTAAGTCCGCAAAAGAGTCGATGCGAGCAATGGAATCATTGGGGGAA
GATGGCTCTAAGGCATGTGCTGTGCTGCAGCTTTTGCAGTGAATGAAAAATGTGTATTCTGCCGAGCTGCTAAGGCCATTCACGACCGCGGGCAATGTAA
TCGTCCGACTAAAGCACATTGTAGACGCAAAAAATTCTGTTGTGCGCCGCATGAAGTTATTCTGGCGCTGTCTAGCGAATAAAGGTACCAATACACCCAC
AAGTACTAAACGATGCGGATCCCAACATTGATCGACGTCGCTCGCAGCTCAACTGCTACATTTGACCAAATTTGGCGATGGTGCATGGACCGTATGCTCA
GCAAGGCCTACTTGGGAACTTCAAAGGCCGGCGACAATGTGTGAATACACTGAAGGCTGCAGCGAGGCCTATGTTGCTTGCATGTTCATCCTTCGTGACA
TACCCAGCGACCACGATTGATCGAGTTGCCTATCCAGTTCGACGAGCTTTACAGTGAGATGGCAGGCCGCAAATGCACGCGATTCGAAAAAGCGCCTTGC
GATCCGGGTCTGTGGTTGATATGTGACGAGTACCTATGCTACGGGGATTCGTGCTGCACTCGTACCTTCATGCCAGATGGACCACCGGTTGGCGAGTGCA
CGCGCCACGCTGTAGAATGTGGAGGTGGTGTCGGCATTGTACTTCTGCTCGAACAGTGCCGCATCGCGATTGTTGGAGGCAGTATGGCAGCACATTGTCC
ATGTCCATACGTTGACTTCATGAAGAAGAAGATGTGGGCCTTCAATGAGCACGACCGCTTCGGCTAGATATGGTTCGCTACCGGTATTTCGAGTCTCTGT
GGCTCAAGCATCGTATTTTTTCACGGAGGTCTCGCGCCAGCGCAACCAGAGAGACCCGCAATATACGATCAAGTTGTCGTACTTATAGTCGCGTGAACCG
CATGTTAGAGTAATAA