Description :
From Genome Similarity Track
Location :
contig_46:220124- 221674
Transcript NameFunction/comments
g8209.t1hypothetical protein

Sequence
1550 bases(100 bases per row)
TAATTTTCCTATACGTTTATCGGCTTTCTCCTATTTCACACTGTCAACACATCGTCAAGGTAGTTGCTCTGCGGTGGTATACCTGGTGGCTTGGCAAATA
ATCTTTGGTTCTCCTCTAGAATCGGTGCATCGGGGTCGCCTTTTTGTTTTTTTGTAGTCCATACTTCATAACCGCCGTCAGCTGCGTTCCTGTACAGGAG
CTCAGCTTTTGCGATTCTGGCAGCTGCTACTTCTGGACTTGTCCTCTCTTCAGCTGACACAGGTTCGGGATCAGAGCTGGTAACTCCGAGCGGTCCAGCA
ATGGCGTCCGTCAGATGGATGACTACTGCCGCATACGCTTGCTCTCTTGTCTTCAATCTGGAGACCGCGCGTGTAAAAGTGCATATTGATACAACCGCGT
GTAGCAGCGACGACATGTTCCTTGGTTGTATGCTGTATGAACGCGTAGAAGTTCTTCCGTCATACCCGTTTTATGATACGTTGAGCGCGCCTTACCGAGA
CGAGCAAGACAGTTCTGCAGATGAAGACCTTCAGCTCTGCCTGGTCTCTCCATCTCTGAGCATTCGGTGTCCGCTGTGAATGAAGGCAGCTGAATACGTG
TGCCGTCTTTCGACTTGGTTTACATCGCTCATCCGGTATTCCGAACGTTTCGGACGGGAACGGTGAATCAGGACACTGCTGCACGCGGCTGGTACGTTCT
TCGTTGGTTAAGTTCAGCCATACTTTACGCATACCACCTCTTCCACGCAACCATTTGTCATCCATTTCCAATTTTGCTTGATAGACATGTGTTCACGTCT
CTGTGTGTTTTTACCAAACTGCATTGCAAACAACTAGACTGCGTTGTGAGCTCGCATTCTCGTTGCACAAGTGCCGTGTGTGATCCACAGCAGAAGCGAT
TATGCAGACGATTGAATTCTGTTGATTGGATATATAAAAAACGTATGGATAGCGTCAGTGGTGTAATTACGCCGAATTGTCATAATTATGCAGCAGGATA
TCTTGTTAGTTGATTGGCTAATAAATATAAAAATTGAATGCATTAGTCAGTAAATGTGTTGTAACCTATTTGTAACCAGTAACATAATCTATTTTGACGC
TGTCGCTTTGGTCTTGCATTTTGAGTGTCCACAAGCAAATGTGAACCAAAGCTCGTCATGGTGACGTCGGCACCGGCAGGAATCGGCTTAATGACAACGA
CAAACACTTTCGTGAATTTCTGATAGCGTGCTCCAGCGACTAAATATGCAGTTTAGTGCATAAGAGTGGCTGACAAAACGAACTAGGCCCCCACACTCTT
TTGCAACGATATATCGATGCTCTTGTTTGGAATTGCAATGCATACTCGCTGATCATGTCCGGGTCCTTGTTGTAGTCATATGGGGTAAGAATACAGTGTA
TTCACCTATAACACAGCCCACAGGGGCAAAACTTGTTGATTATACTCCACAACCAAACCTGGTGCTGACAAGTTTCAGATCGCGAAACTCGTATACGCTC
ATCGAAGAGCGCCCGGAGCGTGCACAATTACCGGGGGTACAGTACATGCC