Description :
From Genome Similarity Track
Location :
Scaffold_93:220109- 224211
Transcript NameFunction/comments
Physo_141063reverse transcriptase

Sequence
4102 bases(100 bases per row)
CCTTGGTGTAAACACACCAAAGGCTACATACATTTACGATCACCATGACGGGTGGTCCATAAAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTTTT
AGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTAGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAA
CAAAAATAGCAGTTCTCATTTTAACTCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAGTTTAA
ACCAAGCTACGCTTCCTCGTACACGTGCGTACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAA
CGACCGACTACCTGAGTTCGTACGTTACCGCACGAGCGCGGAGCTGAGAACCCTTCCCATCGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCA
ACTCACGTTGTACGCGCTGACTGTCTCCACCTGTCGGATCCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACAA
TGCTGCGTACGCTAACGCCGACAGAGTAAAACGGTGTTGCTCTGGGTTTCATCCTGAAGGAGCAACGCGACGTTACTGCTACTACTGCGGTGCCGTCTGG
GACGACACCACGCGCGCAATCGCTAAAGCTCAATGTGAGTAGCTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCAAACTCGACACTGCC
AATGCGGCTCGACGTATCGTCGACTCGTTGTCCAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGAAGTTGGGCGTATGGACGCCGAATCT
CTGATCCTACGTGCTTCAGCACGTATGAGGCTTTCAAGGAGGAACTCAGACAAGCGTTTGAGCCCCCGCAAAATGAGTTTCGGTCGAGGGCAGAGTTCCT
CGACCTACAGCAGGGTAAGCATGATGTCCATGCTTACGCGCAGAGAGCACGGTACTTGGTCTCGAACATTGTGACCAACCCGATAGACGAGGCGACCAAG
GTCGTCCCGTTCATAAAGGGTCTGAGAGATAGGCCTGTAAAGTCCTATCCCTTCCATGAGTACCCAGGTACTCTCGAAGCTGCGATTACTCTTGCGATGC
AGGAGGAGTTTAGTCTGAGGCAGGCTAAACTACAGGCGAATGCGTCGAGGCTGCAACCGCCTCCGGTCGCGATAGCGGGAGGTCCGGAACCAATGGACCT
CTCGAATGCAACGGCTGTTGGTTATCAACAGCAACAAGGAAGTAATGTACGATGCTTCCGTTGCGGAAGGATCGGTCACTATGCCCGAGAGTGCACGGCA
CCCGTGCACCGAGATGGTGGTCGACGCGGCGATGCCGGGCATCGTCGCGGACAAACAAAAAACGCTGGAACCCAGTAGGCGCGGGGCGCCCTACTGGTAC
CGCGTGTCGGCCTTGGACACGCGACACTGAGGACTGCAGCCCCCAGTGAGGTTCATCCTCACTGCAAGAACCAAGATGACAAGCCTGACCTTGTCTTCCT
GAATGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGAC
TTCGAGCATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACAGGTGCCGTCGTGAAGACCGAGAAGCGCATGGTGCGTGCGCTTCACGTAT
GAAGATCAAGAGTTTGTCGAGACTTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGGCATGATCTGGTCA
TCGATTGGGAAAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGACGCCACACACGCACAGACAGGTGCGCGTGA
CCCCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCTTGGGCGCGCGCGAGCACACGCGCAAGAGCAGCTAGCGTCGGCGTTGCCGCTGGC
AACTAATGAAGGAAATATGTTGACCTCGGAGGTCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGGCCTCAAGGGGCACGGATGACGCAGGCGAG
TCACACGTCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGGTCTGGCCAATAATAAGAGCCAAGGTGACGTAACGCCGTCGACTCAGGGAGTCG
ATGGCTTGGGTGCTTTTGATTCGTCGGCTCGGGGAGCCGACGCACCGTCCGTAATAGGGGTCTCCGCCAATGGTTGGCGTCGAGGTAAAGATGGCGTGTC
GGCTCCGGGAGCCGACGCCGGAGGCGGTGCGGACGGTTGCAAACGTCCCGCACCGGAAAAACTTGCATGCCGTCGTGCAGCCCGGCTGCACGACGAAGCG
CCAGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGAACCCGCCGGCGGTACAGAAGAAGAACATCCGTCCACGGCTGGGCCTTGACGAGGTC
AAGAACCAAGCGGAGCCGGGCTCCGCAAAACAAGAAGACGGCGCATGCGAAGATCGCTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGAAATGTC
TGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTACCTGTACCGGGTTCCGGTACAGGGAGATGACTCTCGCTAAT
CCTCCGACGCAAGCGTCGGAGTTGACTTCTCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTC
TCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTTATGGAGAGCACCACTGAGAGCGAGGACACTCTAAGTGCGAAGACTAA
GAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCGTTGAAGACGAGTCCCTACTACGATATCTTACGGGAGTACGCGGATGCGCTTCCGGAAGAGATCCCT
GCGGAGCTTCCGCAGGACAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGCACGAAGTACTGTGTCACGCGGCAGTGCCGCGAGAGCAGGTCAAGCC
GATCGACGACTTCTTTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGC
GGCTGGCGCAGCGTTCATGCGTACAACAAGCTGAACGATGCGACGATACCGGCGCAGACACAGATACCACGAAAAGATGTCATCATCGATTCGATGGCCA
GGAGCACTATCTACAGTGCTCCTGATCTGCGCGACGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCGCTCTCACGGCTGTGAGCACGCCGAGCGG
CATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAATAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTC
GCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCAGACGGGATGAGCGACGTTGAGATGCACAAGGTGCATCTCCAAAGGCTGCTTGCGC
TCATGCGCAAGCACAAGCGCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTCGGAAAGAACGGTGTCCG
CCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGCCAAGGAACTGCGGCAGCTCCTTGGCTTGGTCACGTACTTGTGCAAG
TACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGCCAGCAGGCCTTCGATG
CAGTCAAGCGGGGCTTGACTGAGGCGCCAATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCTGACTTCGCAATCGGATG
TG