Description :
From Genome Similarity Track
Location :
Scaffold_41:220109- 223155
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14752hypothetical protein
Phypa_INRA-310PPTG_14753hypothetical protein

Sequence
3046 bases(100 bases per row)
TGCGGGAATGCTAACACGTGACCCTTGCAACAGCATTGAGTTGCGCTGTGTTGCGAATGCCGCGATCCATCACGCATCCACGTGCACGTCGGCTCGTGGA
GATGTCTGTACAGCAATCGCAACATAAAAACAATTTAGTATTGGGTACATAAGCCTACAGACACTAAAATGAACTCACGCGCAACAGCATGCAGCTCTCT
TCTGAGTAGGTAGCGCACGTACAGCACCTTTCGCGATCTCGAATGCCGTCGATACTGTATGTCCGTGAAATAATGATAAATAAAAATGTTTTGCAAACAT
GGTAGCCGACGCATCGACCACAAGTGAGTCGGAATGCACCGCTACGACGTGTGGAATCCCAGCGTTCAAGAACACTGACGCGACCTTCTGACTATGGCAC
GCGTTGACGAACACAAGCTGCACGTTGCCATCCAACGGTTTCGGTCCTGTAATGCCAGAGTCGACCGTCTTCATCTCCACCGGCGCCGCTCCTGGCACTT
GCTGCTGTCTTCTATCACCCGAGAACATCAACTGTCGCAGTGCATCGGGCGTGATTAAATGCGTGCAACCTACTCCATCTTCGAAGCAAAGAGCCGCTCG
CTGACCCAGTCCGTGACCCGAGAAGTGCAGTACTGTGCACTTCCAGGCCGTCATGAGGCTGCGCAGGATATCCGCAGTGGCGATGTCGAACCGCACGTGG
ATGGCCTTATGTTGCACGTCCGTAAGCAGCGAGTTGCTGATCTCCCTGCGCTCCGCCTCCAGATCCAGTTTCTCCATAGGATAAATGCGATGGCGGCTGT
CCTTGATCACGAGCGGCGCCGCGTGAAGCACCACGAGGTCCAGCGCGTAATCGTCGCGAGGCAACCAGGCTTGATTAAGTTGCTGCGAAGTTGTCATCGT
TGAAGTTGTCGTGGCCGAAATTGAAGTCGGCGATGGTGCAGACTCGCCTGCGGATGAAGATGCAATCAGCGCCTCGATGGCTTGCGAGATCCGCACTCGG
TCCCCGAAGGCCGCGATGCCTAAATCGTCACGAAGCGCGTTGCGAGTGAGTTCTGGCAGGATGGCGCCCGATATCTTGTTGGCGGCGAAGAGCTCCACGT
GCTCTTGAAAGCCCTGCGCACACAGCCATTGCCCCACGTCGGCGCAGGACCAAGAGCTCCATGGCAGTGCGGGCGCGGCGCCCTCCATTTGGAATTGAAG
TGAGATAGTCACTAGCTCATGAAATGTACCTATATGTCGAATAAGTAAAATGTACGGTAAAGATCGCATTATTAGCATCAGAACTGATGATGATGTCTCA
GGTCTGATCCCGATAGTAGCACTTGGTCCATTCGTTGGAAATGTCTTCCGCAGGGGGCAAGAAGCGGCCGCGTGCCGACCTGCTGTCGTCGCTGGACGCG
GCTTTTGCATCTACCGCACAGCCTGCAGTATCCAAGTACACTGCTCAAGCAACAGCACAATCGGCGCCCAAAGGAAGCAAGCAGCAGGCCTACCAGCACT
CGAAGCTCAAGCGCAAGGACAAAAAGCGCGACAAGGGTGGCAATGGTCGAGGAGACGACAAGGAGACAGACAAACAGTCGGGGGAGAAGGACGTGGAGGA
GAAGAAGGAAGTGAAAGTTGATCCGATGTATGAGAAGATGGATACAGAACTACTGGCAGTTGGGTTGAAGAACTGCTCTCTTGTAAGTCACTCAAGTTGT
GAATTATTTGGTGCAATACTGACGTTTTTATTGCAGCAACCACAGGTAAAAACGTTGACGAAACCGCGTGCATTACACGAGACTCTCAAGAACTACCTGG
AATCGGTGACCCAAGGCACCAGGGCAGGTTCAAATGCCGTTGACAGTCTCAAAAACAAGGTGTTATCGTTGGACAACCCCTTCAAGACTTCTGCGACAGA
GACGGCGGAAAAAACGATTGCGGCAGCTAGCAGAAGCCAGACGGCCAAGTTGCTAAGTGCACGCCAGCGTAGAAAGCTCGGACTGCATATGCTTGGTGGA
GAAATGAAGTACAGCGATGCCGAGCAACTCAATGATATTTGGACGCGGTATGTCAGTCAAGTGATCGAGAGCGAACTCAGTGAAGTACAGTCAGTTACTG
AAGAGGTGCAGCGCACGCGCAATTCAAAGCTGCAGGCCAAGCTTAAATACCTGGATCTGTCTGGATGCCGGATTGAAGGTGGGTCGGTGGATCAAGCATC
TGCTGGAGTAGACGATACTAATTTTTTTGCTATCTTGCCCGTGTCCTGTGCAGTGATTCAATCACAAAATCCGCTTAACGTTGGCATCCATGGCATCATC
GTCGCGGAGAGCATGCAAACTGTGCAGATATGCCGTCCTGCTACGTCAAACAGCGACAGCACCAATAGCTCTATTTGCTGTACGTGTTCACACACAACTT
GTTTTCGTGTGATTTTTCTTACTGTGAAATAATGTCCATAATGTCTACAGCACTGGTGAAATCGGAATCTCATTTCAAGGTTCATCTTAACCCGACGCGG
AGCTTAGTTCTCGATGGTTCCTGGTTCGCAGTGCGAGCACAATAACCTGAAATGAGAAATAGATTTGGTACGTTTCGAAGAGTATAAAAAACAAATGTGA
AAAAAAACGTTTTTTTTAGTCAGAGGATTTCGTGGTTATGCGTTTTTAAAACCAATAGAAAATCTGATATTGAAGATTCATTATGCACAAGAGTTCTGGC
ACCAGCATCATGACTCATGCACAATGTTGAGCAAAATGACCGGGTTTTAGACCCAATAAAAATAGTTTAAACGTTTTTATCAGTTTGATTTGCGATTATA
CGTAGATGACCAATCCATAGAAATGAGTGAGTCGATTAGAAAACTTGTACACTATGTAAGAAAAACGTTACTAAACCATGCTGTAAAAATCGATTTTGAA
TGTTTAATAATAATGTCTGTTAAAACAAACCGTTCTTGACATGTTAGAAACGTAAATAATGCCTGTGTTTGTGATAAGAAGCAGATCACAGGTCGAAATC
GTGGCTTGATTGGTCAACTCAGCAAAACAAATCTGATTCAAAGTTA