Description :
From Genome Similarity Track
Location :
contig_47:220085- 265557
Transcript NameFunction/comments
g9218.t1hypothetical protein
g9219.t1RAW27616.1 hypothetical protein PC110_g15977 [Phytophthora cactorum
g9220.t1hypothetical protein
g9221.t1POM57719.1 Rab11 family GTPase [Phytophthora palmivora var. palmivora
g9222.t1XP_009523306.1 hypothetical protein PHYSODRAFT_313196 [Phytophthora sojae
g9223.t1OWZ20327.1 Importin alpha-2 subunit [Phytophthora megakarya
g9224.t1RAW28617.1 hypothetical protein PC110_g15014 [Phytophthora cactorum
g9225.t1hypothetical protein
g9226.t1hypothetical protein
g9227.t1RAW28614.1 GMP synthase [glutamine-hydrolyzing
g9228.t1hypothetical protein
g9229.t1hypothetical protein
g9230.t1hypothetical protein

Sequence
45472 bases(100 bases per row)
GTTGTTTCAGCAACACAATCTCCTTGTCCGCCTCCAGTTTCAACGCCACATACAAGTCGCGGAGTTTCTGGAAATGGCAGCACCATTAGTTCCTGTAACG
ACGATCTCTTACAGGTGGAAGTGTGTCGGTGCGATTGCTTACCTAGAGCTCTCGCCTGTTATGTACTTCTCGAAGGCACCGACTCGGAGCCATCCACTCT
TCTCGGGGCCTCCAAGAAGAGTTTTCTTGGCCAATAAGGTGGTTTTTGTCTCCGACTCGGCAACTCATTTCAACCGTTCTTGTTGAGGTTCCTACTCGAG
ATGGTTGTGTCCACGCTGAACGATGGATATGAAAGTGGCACCATGGAGTCAGCATTTTGTCTGCAAAACCTTAGACCTGGAATGACACGATCTTCACGAA
AGGTCGTCTGTCGCCGTTGAAAACACGCCAAGACACCTTCGTCCTCCCCGATGCGCTGGTCTCCACTTGTGCTGCTTGGCCTTCTCTTTGCCATCTTGCA
ATGTCTAGCGTGTTGCCACGCGAAAACGATCGATTATGAAGCGCTGGAAAAATCGTGGGAGGTTGGGGACAATGATGCAGAGCTGCGCACGGAAGGAGCC
GAGCACTATCGGCAGCTTGCAGACAAGTGAGTGTACCATAGCCCTCCTTGATACAGCATGCAGCTCCAGCAAAACTCATTTGTTTGCCCTTTTTATCAGG
AGCGAGGACGAAGCGAAGGCTCTCGGTCCTCAAATGATATTCGTAACGATGAAACACGGCGGCGATCAACGACGAGAGCCTCTTCCTGGCGTTGCAGCAC
GATGGAAAGAGGTAAGATTATAAAGCGGTGGCTGCATGCACTAGCGAACTTGTAAGTACTTACATGGTTGGTTTTTGCAGATGCTGTGGAATGGTGGGAT
CGAAGTGAACATCTACGAAGTTGCCGAATCGAAGCTTCTCGTTGGACTACAGAAAGGCATGTTCGTCAACGATGTCATGCGCTTTCTCGACCAGCAGCGA
GACGTGAGAGAGTACGAATGGAACGGCAAAACGTATTCACACAGCACCAAGTCGACCAAGCTTAGCCACCAAAACCACCGTCAGAAGAAAACGAAAAAGG
CTCACCGAAAAAAAGCACACCACCCACAGTCTAAACGCTCAAAACTAGGCCATCACGTGCACATGAACGGAAAACAGCCTCGCCCTAAAACTCCTCAGCC
CGCATTCTCTGAAGACACTGCACAACCCAAGATGACAGAACCTCCCCAGCGTAGCGGGCCAAACGATGAGCTGTGACATTAAGGTCAAATGTTTATCTGA
ACACAAATCCACTCATTTCCACCATGCTCAGCTCTTTGTCTCTTGTGTCGGTTCGGCTTAGTTGCTCGTGCGCTCACTCCGAATAGTTTCAAGCAACGGG
CCCAGCATCTTGTTCTTCTTTGCGTTCTCCATCACGGTGTGCAGTCTCGGGTGGGAATCTGCGTCACGCACAGCGCTGATCGCTTCCAGAGCACGTAACG
CGCTACGAATGAGATCCTTCACGCGCTCAACCTCAGGCCCAACCTGGTCCTCTTTGACCTTCTTGTTGATCGTCTTCTCCAGCGGCTCGACCAAAGAGTC
CAACGCACCACAATACTACCAGGCTGAACGTAGCAAATCTTGATCAAGATTTGGTGACTAAGCATCTGAACGTCGTCCTGGTCTCCCAGACCGCGCTTCA
GCTGGTCGAAGAACAGCGAAATATCCAGCTGCTGCGGTAGCACCTGGATCAGTGTATCCACACACGAGTACGCAGCCTTACGGAGCGGAAGCCCATCATC
CACCTTGTGTTTGAACGGACCGAGGTCAACCACTCGCTCCAACTTAGTTTCTGTCGCCTTCAGGAGCACTGGAAGATGCGCTCACGGACGTACGGCACCA
GATAGTGCGCGTGGTGGTGAGCCGCCGTGTTTAGCACCAGCAGGGCAGCCCGGCGCACGTGCAAATCTTCGTCTTCAAGCGCCGCCAAGAAAGGGTCGAT
GTGAGCGAAGATCGCGTTGACCGCAGGCTCTTGCGCCGTTGTCGTCATCGCATACTTCAGACTTGTCACGGCGGTCCAACGAGACCATACGTCAGATGAT
CCGCAAAGTTCCGTCACAATGGGCATGATTTTTGTACTGTCCGTCACGGCGAGTTTCCCCATGCATTCGCCAACCATATTGCGCACCCCCTCTTCTTGAC
GAGCACTCATCTTCTGTAAAACTGGCAGCACGCGGTCTACATACAGCGCAAAACCGTGGTGAGGCTTAGCTGCGTGGTCCGAAATGACTTCGCGTAGCGA
CGTCAGCAGCAAGTAAGAGTTCTCTCCAATCTCCAACTTAACCATGATAGTGTCCAGGTACTCTTCCATGTTGCCAACGCAGATACTACCGAGAGAGTAC
GCTGCCGCAGCCTTCACTTCCTCGCCCGCATTACTGAAGCACTTTAGAATCGTCTCCTTCACGTCGGTATACCCAGCAAGCTTGATCTTGCGGCCGAACT
CGCCCAAGCAGTATAGCGCAAGCACTTTGTTCTTTTCGGACTCCGTTTGCGTGATGTCACCTACAAACTTAGCGAATGCCACCTTGCGATTCGTTTCAGT
TGTAGCCACACATGTACCAGCAACACACCGAGCGATGTTAAGCACAGAATGTTTCGATTCTTCCAAAGGTGTCGCCATCAGCGCCTTGAAAAGTTCGGTG
AAGCTGCTGCCCGGAGAGTTCAACTGTGTGAGTTGCGCGAAGAATCCCTTCAGTGCATCCAAAGTAGGCCCCTGGAGCATGGAGCTATGACAGAGCTCCA
GTGCCTTCACTTGAGCATTTTGCAGCAAAGCGTCTGTCGCAGCAACGTGCGGACACACGCGGAGAGAGTTTGACACCAGCGTAATGCTCATGCGGCACAA
TTGAAGGTCCACGTCGACAAGAAGGAGCGAAGCTTCTTGGACAACTTCGTAGTGCAGAGACTCCGGCATGCTAGCTCCCTTGCGCACAACCAGATCATTT
AGGGTAGCCAGTGTCGCTTGCTTCAACGTGCGAGACTGCTGGCGAAGCAGCTGGGCCAGAGTTTGTGTGCACTCCACCAGAATAGGGGACATATCCAAAT
CGAGCTTGGAGCGAGCAATGACTCCGATGGCCTTGATAGTCTGCACTCGCGTGATTTCGTTGTTGAGACGCTCCATGAGAAGCGGATAAATTTCGCCCAC
CCGGGGACCAAGTTCGTCACCTACAATCATACCAGCAAAATGTTAGCAGGGAACACTCGCTTCGTGAATAAAGTTGTCGACAACGTACCGAGGACAGCAA
CGATCTCCCCAATACTGCTGATGGCAGCCTCCTTAATCTCTTGATCGATATCATGAACCTTCAAGCTAGGCAACACCGCTTCGAAAAAAGGCACAGCGTA
CGGCTTGTACGCCATGTCTCCATCGTCAACCCGAATAATGCGGACTAGAGACTCAATCAACCCCAGCGCCTTTGCCACCGTTTTGTACCAGTCTCCCCTC
GCGCATTGCACTGCAACGTTGATGACCGAATCAATATGCGGTCGGAATGGTTCCACCGTGTGCGTATCCACGAGCAGTCGGAGAAACAGAAGTGAATCCA
GCTTTAAGTCCGAGTGCTTGTCCTCCACTGCGTTTAAAATATTCGGCATCAAACGTCCAATGTAGTCTCCCAACTTTCCGTGCTCCACCATGGCGAGTTC
GCTAAGCATCGCAACTACAGCACATCGCGACGGAACTGAAGACTTCGTTCCAAACTGCTTGTTGGCTCCAGCCACGATCGTGTTAAGGCGCTGCTCCAAC
TGCGTAACGCATCCGTTCGACTTAGGTGGGTGAAAGGAACCAGCTCCATTTGAGCTTGGAAGTGTCTTGTGAGTCGCACGAAGAAGCTCTGCAAATACGC
CAAACACGTCGATCCGAACGTTTTCTTCTCGCTCTTTGAAGCGCGAAATAAGGGGCTGGGCACAGTGGATGTAGAGATGTTCCAAAAGCTCTGATCTCGT
TGTGATGATAGCAGTCAAAACACGAAGACTGGCACGACGGACCTTCCAGCTGGTGTCGTCATCGTCACTGTAGTCGCCTTCCTCATCACTGTATTCCTCC
TCTTCCTCTTCCATGTCTTCATCTTCGTCGGCCGAGTCGACATAGTTGTAGTTGGGGTCGTACGAAATAAATTGCAGCACAAGCTTCAGAATAGCTTCAA
CGTGAGGCGTGATCTCGTTATGGCATCGAACGATAAATGCTTCAAACGCCTGGAAGCAGTTGCCTCGAAGCTCATCTGAGTCTTCGTTTTGCAATGACTC
GTCCTCAGGGTCTCCGCAGAACTGAACCAAGATTGGATCACGGCGTCCAAGTGCCGCCCAAGACGGTGGCCTGCAGTGCGCGAGAGCATTCCGATCGTCT
GGATCAACGTGCGCACATTCGCCGAGTCGGTTGAGCCCTGAATGCCCTTGATCAGGTGCTCTACCAGACGGCTCACCAGCACGTCAGACGCCATGACACC
CAGCGACCCCACACAAGCCGTGGCCCGCTTGCGCACCAGCGGCGATTCGTCAGTCAGCTGCACCATCAGCAGCTCCATAATCGTCGCGTGCTCCGTTGCG
ACGTCGTAGCCAAATCGACGCAGCAGGTCCGTGAGGATGTCAAGCGTCTCGGTCTTGACAGCCGCGTCCTTGTCCTTGCCCAGCCCCGTGAACAGACGCG
TGCAGATGCTCGTGGCAACAGACGCTCCCGTCGTCTGGGACACGTCCGCGACGATGGTCTTGAGTCCAATCGAGTAGATATCCCGTAGCTCCGGCTTGCC
GTTGAGAATGAGGTCGCAGAGCTTGGCGCAAATGTCGGCCACCTGCGCTACCTGCACTTTGGTCACCAGGACGCCCAAGCACTTGACGGCGATGGACTGC
ACGTCGTTCGACTTGTCGTCCAGTTGCTTCAGCACCGCTGCACACACTCTGTAGTGCCACCATGCACACATTTAGCCCCTTTCCTCAACTAGAAGAACTA
CAAGCGCCTTACTTTGGCTCGAGATACGGCCCCAGCTCCACGTCCTTGTTGAGCTCGCTGCACAGATCAGAAGTGGCCATGTAGCGCTCATCCTTGTCAA
AGTCCGTGGTCTGCAGCACACACACATACATCAGCACCAGACCCCACTGGCTACACGGAGTGAGACGCAGCGCACCTTGTCCAGCAGCTGCGCGATCTTG
TCCTCGTTCGCGCGCATGTTTCTCCTCCTCCAAACGTGAAAGCGAGTGATTTGAAGGATCTCGGAATGATCATGTGCACCACATCAACGACCATCACTCT
GGAACCGTTACTTCAACGTTGGCTCGCATTCGCGTTTAAGCAAGCGACGCCCATGAGTGCGACGCGCTGCTAGTTGCTTGCCGTATATACGTCGATAAGC
TAACATGTCTGCTGTGAGTGTGCGCAGGCGAGAGCGACAGCACCGTGGTGCCTGACCAGCTTGCGTCCCTCATTTCGGATGAAGTGGAGCGCCAGCTGAG
AGAGCGCGGCTCCGTGCTCGAGGCCATGAAGGAGCAGATGGCCAAGGTGCTGGCCGAGTTCGAGGAGATGGCGGTCAATGTTAGCTCCAAGCGCTCGTGG
TCCAACAGCGTCGCGAGGACGAAGCCCTTCGCCTCGCCCAAGAAGGCGCTCTTCGACATCCACCCGGTCGTCACGCCCCTGGATATCGTCCCTTCTTCAC
CTCCAAAGCTGCCCAAGTAGGAGCAGTGCAAACTGCAGAGTGGAATGGATGTGCGTCTCACCTGGGTGTGTATACTTTTGCGCAGGATTAGCGGCGGCCT
GCTCAAAAACATTCATCAGCTTAAGCACAACGCTAGTGGTGGTGCCCTACCGCCAGGCGGAGCTCGTAGTCCCGACGGCAAGATCACGTTCGGTAAGCGC
TCATACTACAGTGTAAGGAGCGTGTCCTGGATGGTATATTTTAACTACGTTGTTGACCTCTAGACAAAATACTTCCTCGAGTTGCTCACATTGAAAAACG
CACTGACGGTGCACAGATGATGTTATCGCAGCAGAGACAGCAGATGTACGAACGAGCTCTGGTACGATATCCGCAATGCCGAAGCAACGTTTTTGCTCCC
AGCATGTATGATCACGAAGAAGTGTCCAACTTGGATGCAGGCTCAGCACCTCAGGCACCCCGAGCGTCACTAGAGCTTGATTTCGTATATGGATGCCGAA
GTGGAGCCACGACGTCGCTTTCCAGCAGCCATCCTGCAGCAGCACCTAACACTAGTACCAACAACAGCGCTTTCTACCTGTCAACTGGTGAAATTATGTG
GTTCGCAGCGACGTTAGTGATTCTTTACAGGAAAGAAGCGAATACCCAGAGGTATTTCCGGGAGCACACGAACGAGGTGACGAGTATAGCAGTTCACCAG
AACCAGCGCATTGTAGCATCCGGCCAAGCAGGACGATCGGCGTTTCTCTTGGTATGGAATGCGAACGATGAACCGCTGGGCAAACGGTTTGCGTGCCTCA
AGGGCCACCAAGTGGCAGTGCGCTCCATCAGTTTTTCTCATGACGGTAAACTGATCGCTTCGTTGGGTGGAGATATGTACAACACCATTTGCATCCACGA
CTGGAAGGCGCAAGAGTTATTGGTAAGTGCTCGGGGGCACACGTTTCGGGTTCATGCGGTTGCATTTAATCCTTTTCAGGCATACGGTCGGCCAGAAACT
CAGCGATCAAAGAAACCTGGCCAAGCTTTGCACGATGACGATGCATGCTACACCCTAGCAAGCTGCGGCGTCCGGCATATTCGCTTTTGGACACTGACAA
AGTGCGTGCCCCCTCCATCAAAGGAAAATGTCGACAGTGCATTTTCACGCTCTACATTTGGTGGTCCTCCAAGATTGCGTCCTCCAACACCGACTGAGAA
GGTCTGGAAGCTGGAAGGCAATGTTCCATCGTTCCATGGTCGATTTGAGGCTCAGGACTTTACAAGTTTAACGTTTGTGAACGATTCACCACCTCTGTAT
ATGTATGATGAACACTCCAAGGAGTTGACGGCCACAAACGCAACTGATCATTCGCTGGGTCGGATCGTAGCTGGCACGGCTAACGGAGATCTGTGTCTGT
TCTTGCAGCCAAGGGCAAGCCCCAATATTGATTTCGTTTCCGAGGGTGATCTTCACAAAGAGCCTGCAAAATGGTGGGAAGTTCCAGACGAATACACTGA
TGCTGAGATCAACGAACTCGTATTAGAGAAAATCGCATACGAACCAACAGCGAGACTCGTTGATATCGTGCCTCATGACCAAGAAACTGGTAATCGATTT
AAACTACCTAAACAAGCTCAAGCGGAGATGCAGAGTTTATCCAAGAAAATGGCGTTGAGGCCCAACTCAACGGCCTTGTTCTCACGGCTGGGTGAACTAA
AGTATAGCGGTCCGTTAGCTCACCAAGGAGCAGCTTACCAGGTGGCGTACTCCAAGAAACGCAATACGATTATTTCATGCGGAAATGAAGGCAAATTGCT
GCTGTGGAAGTGTGAAATGAGTAAGCCGCTACGAATCCCTGGAGTTAATACGTTAGGAGTCTTCACACCACTGACTGGAACATTTACAGAGGGGTCTCAC
GCGCTACTTCCACTCGATGAAAAGGTATTCTACTTCCCAACTATACTACCACATGAAGCGAGTGCGGGTAGCGCTGCTGCTGCACCCAAGCCCACAAGTA
TTGTATGGAAAGATGACGGGAACTTCGTGCTTGTTGCCACAAGCAATAGCTGCGTTTGGGAACTAAATGTCGAGTCCGGGGATTGGCAACTACTGTTTGA
AGCTCGCAGTGGAGCTGTGACAGCTTGTGCTGCACATCCAACTATGCAGGAAGTGGGGACTGTATCCCAAGACGGATATCTTAGCATCTGGGACCTCCGA
CAGCACGTGTGCATTCGCCGCCTGTATCTTGGGAGCTTCATCACCGCTAGTGTCAAAGCCTTTTGTATGGAATTCCATCCAGCTGGAAGCGAAATCGCAA
TCGGGCTCAGCTCAGGCGAGCTACTTGTTGTCGACTATGATTCATTCAAGGTGTTGCTCCGGAAGAATATCAAGTCGAACTCCGGCAGCACTGCCAATTT
ACGTCTCTCCGGTCCCGCGTTTCGAGCAATTGCTCAGGTGAAATACTGTCCAAATGCAAAGTTCTTGGCAGTGGGTGTAAAGGACACTTTCGTTTACATT
TATGATATTGTGAACGGGTACAAGAAACTTCACATTTGCGAGGGCCACTCAAGCGCTGTGATGCAATTAACTTGGAACAAGGATGGCGATATCCTGCAAA
GCAATGCCACCGATGGTGAGATTCTCCACTGGATAGTATCTCCTGTTAAGGGTGAAACCAAACAGATTACTGATGCGTTTCTCGTCCGCGACGTTCAATG
GATTAAATGGACCTGCGTGTTCGGGTGGCCTACGCCTGGCATTTGGTCCGAGGAGTCACCCAACCTTGTAGACATTGCAGCAGTCTCCACTACAGGCCCA
AGGACTGCTAATGAGTACGATGAATGTGGAAACGCTCACACCACCTCCAACGAGGACTTGCTGGCAGTAGCGTGTCGATCCAGTATTCATCTTTTGAAGT
ACCCCGCTCATCGTGGTGCCAAACGAAAGGTGTACAAGGCTCATTCGTCCGCTATTTCAGCATTGGGATTTTCATTTGATGATGCATATTTGGTTACTGT
TGGTGGAGATGATGGAACTCTCATGCAGTGGAGCGTTGTGTTCGATACAACAAGCTCCAGCCCTGCTGGTGTTAAAGTACCAGGTAGCACTGAAAAAGAT
AAATCCCGGACACCATTTGCAGAAGATGATAGCACTGGAGAGCAGTGGTCAAGTTCGAGTCCTGCCCCTCCCCCGCAGGATGGCAAGCAACGATCAAATC
AATTGTCTCCTCGAAAACATTCTCGGCAGTACCGCGAACGCCTAGTTTATCAGGACGATAGTAGCCGAGAACCTGAACCAGTCGGTGAAAGCTTGCATCG
ACATCCGAGTGAAGAAGAGCCGATAAGCGATATCCGCAGCGACAATTCTAACGAGGACAGGAGTTCTCAAGCAGGTGCCAGTGGTCCACCGGTAGAGCGA
GGTGTCAGCTATCGAGGTAGTACCGATCTCGACGAGCCCCGTCCTGCACCTGTCCAAGTTCGAGCAACACACGACTACGCAGCTGAAAGCCCTGACGAGC
TTAATCTCAACCGTGGCGAGATTCTGCGCGTGCTCTCAAAAGCTGGTAGCGATTGGTGGCTGGGCGAGACTTGTGATGGTACCAAGGGCTATTTCCCCGC
TAGTTTTGTAGAAGACGTGGACCTTAGCGCTCCCGTCTCCGGCGACGAATCCGTACCAAACGAGGATCCGCCAGCAGAAGGGTAACTGTGTTAATTAAGT
TTGCATTTGCTTCTGTTGCTTTGAAGTTGTGTCATTTGCTGCTGTTGAAGTTGTCTGCGACGTGTGACGCAAGATGGCTACAGTTTCGGTGGCTCTAGTT
GGCCATTTGATCTCATGGCGACACCGCCGTCGGACACGGCGCTGGGTGCCACCTCGACGACGTTCAGAGACCTGCCGCTGCACGAAGATGTTGCTCATGC
GCTGACGGCCATGCGCTTCCTGCGCCCGTCGCCGATCCAGCTGCATGCACTGCCCGTGGCTCTGTTCGGCAACGATGTCATCGGCCAGGCCAAGTCGGGC
ACTGGCAAGACTGCGGTCTTCGGAGTCACCGCCATAGAGCATTCGATTCGTTATGTGGAGCAGCGCGGTCAGCAGACAGAAGAGCTGATGGTGGGACATC
CATTAGCGCTCGTTCTAGCGCCCACGCGAGAGATTGCAGTCCAGATCGAGAGTGTACTCCGTCAATTGGCGCAGTTCCGACCGAGCTCGTCATTCGTACG
TGCATCGGCGGTCTACCAGTGGCGCAGGACCAGGTAGCGGAAGCAATACATACGCATTCAACCGGTAGAAGATTGAATGGAGCTGGTATTTGATGTTTGC
AGATGCACCTGGCGGCGGGCTGTCACATTGTTGTGGGCACGCCTGGGCGCGTGAAGGCGCTTGTGGATCAGTGCTCACTGCCGTGTAGTGCAATTCGACT
GCTGGTACTGGACGAGGTGGATAAACTCATGGCGCGAGACTTTGAGAAAGATGTACGACTGAATGGATGACATTGGTTACTTAGCTAGGGACTGATTGCC
GTCATTTCGATGCGTGTACAGATCCAGTATATCGCGGACGCTCTCCCTGAAAGACGACAAGTAACACACTGTCTCTGTGACGAAAGCTACATGTGATAGT
TACGTTGCTACTTTGATTTTGTGGATTGCAGACCCTCGCATTTTCTGCCACGTTCACACCCGACCAGTTGATAGCTGTGACCCAACTAATGAGGACACCA
CAGGTATGTTGGAAGGAACTATATCATGAATTACCCAGTTCTCTATATACCTGATGATACTTTCTCGCGTAGATTGTGCGCGTTCGAGGCCCGGGTGATG
TAACAACCGAGTTCATTTCTTCCGCTGAAGATCTTTCAAACTGGAAGGACCGAGAGCAGTCAAACGCGCCTGAACTCTGGCTTCACCATGTGCGACAGTT
CTATAGCGTCGTCAAGTCCGCGCCTGCATCAGCCATGGGAGATGATGTATTGAATATGAAGGCGAAGGTAGTCAAGTTGGCAGCGCTGCTGTCAGAAATC
GTATTTGTGCAGTGTATGGTGTTCTGCAACGACAAATTTCGCGCGGAGGCACTAGCCACAGCTCTTACAGCGCTAGGCTGGCCAGCAGCATGTATCACTG
GAGCTCAAGCTCAAGCTACCCGCCTGGAGGTGATGGAAGACTTTCGCGCATCCCGCTCGCGTGTGTTGGTAACAACCGACCTCACCGCGCGAGGTATTGA
CGTCGACAATGTCAACTTTGTGGTACGTTGTGTGGAAAGCGATATATAGGCGTGTTCAATTCCTTATCTATGAACTGGTAGGTGAATCTGGATCTGCCAC
GTGACCCAGCGACGTACTTGCATCGCGTTGGAAGGACTGGTCGCTTTGGCGGGAAAATATCCTTTTCATCATGTCTCCTGCATTGATACGGTTGAGTTTG
CCGGACCTCACTGATTCCTTAACCAAGAATTCTCTTTTGTGGTTGTTGTGCGTGCTTACGGTTTAGCAGTGACGCTGCTCTCTAGCAATGAAGTGCAAGG
AGTCCATCTGCTTGCTCGAGTATTCAAGATGAAGATCAGCGAATTGCCAAGTCCAATACCCCGGGAGATCTACTCATACGCAACTGAAGTGGAAAATGAT
GACTGCAGTGGCGAAGGAAATGAAGACCCTTCAAAATCTGCGGTGACAGGAAAATTGCAGAAGGAAGATCGTACCGCATCCCATGAACATGAAAATGACG
AGGAGAATGCCCCCGACTGCAGAACAGGTCGTCGAGGATAAACCGTTGTCGAGAGAGACCTCAAGTCGTTATGAGAGGGAGGAAGGCTCGTATGAGAGCT
GGGTGAAGTTGCTGTAGCCGAGCACGGCGCTTACTTTCTGGATCTACGAAATAAATGGCACAATTTTGACATACAAGTAGTTGATTGATGTCAAATATGG
GGATCTCGTGCACCGAAAAACTAGCCGAACTTCTTTACGATGCGACGCAAGGTGTTGACGGTCCGAACCGTGACTGGAACACCGAGTTTCTTGTCGAAGG
CCACTTTGAACAAAGGGGACTCGCTCATTTTGGTGGTGGAGTACCAGACAAACGCTTTGTCGAGCAGTTGAAGCTCGTCAGCTGCCGTGGAGAGAGACTC
GACGATGCCTCTCTGCTCCTGAGTCAGCTCTTCTTTCACAAGCACCACATTGACCGCTGTCGCCACCTTCACAACCTGATCACCTAGTCGTGCGACATCG
TCCATGGAGCGAGCGAGCACTGGAATGTGGCACCCGAAGAGCCCTTCGAGCGCGTCCTCGACTTGGTGTTCGATGGCAGACACCGAAGACTTGTTTTCTC
CGGCGGGTGGGTCGAAGATGACGTTCCCGCTGGCCAGGAACGTCTCGACGTTGCCGAATCCTGCCTTGCTCAATGCGTCGGCAATCGACTTCATGCTGTG
CACGCGGCCTCCGACGTTCACGCCTCGAAGGAACGCCACGATCTTCCTGGTGGTGTTAGTCGCCGACGTAGTGTCATCGGATGCATGCGCTGGTGGGCGT
GTGTCCTCAATTGTGGTGGGTTCGGCAGCAGCAGCAGTAGCAGTAGCAGTAGCAGCAGTACTAGCGCGCGTGACTCGCTTGACTTTGGCTGGGCTCTCCG
TCCCAGCAGATGGAGCCTTCCTCTTGCCAGCCATCGCAGCGGCGACTCTCCAGCGAAGGTGAGAACGGGCTACTGAGATCCATCACAAGCCATGCCTCTG
CCAGGAATGACACGCTCGAGTACCAAAGCGCAGCCATTCGGGCGAATCCTCACTTGTGCAACTTGCAAGATGCGGTCTCTCTTCGTCCACATCTGTCCAC
CATATGCAGCCTGCATAATCCTATTTAAGTCAAACATATAAGGTATCATCGTCAAACTATACATTTGTAAGAGTATCTATATCACCCTCTCTATTGCTCG
CCCGTCTACTGCAATCCCTGTCTAATAAAGCGCGTTGTTCCGCCCTTCTTCGCAGGCGGCGTATAACCGACTCTTCCTCGCGGTTCTCGCGCTTCAAGCG
TCTCTCTCTCTGCCGAGGCGTCGCCCCCTCCGCCTTCGCTGCCACATCAGATCTTGCCTAGTCATGACCACAGGCGTCGAGCCGTCGTCGTCCGCGACCG
CGTCGTCCACGTCCTCCTCCGTGACGGACAACAACGCATCTCTGCAGCAGTATATCTCGGCCAAGGAGGTGGCGCAGCACCAGGTCTTCCGTCAGCACGA
CTTGCGGCGCTCCATCAGCTCCACGCAGTTCAGCGGTGCCTCCAGCCCGGCGGCCAACGGCTCCAAGGCCTCGGCCGCCGGGTCTTCCATGTCGGCCTCC
AGCAGCCCGCGCTGCTCGTCGCCGAACTCTTTACCCGTCGCCGAGTCCATCCTCAAGGTGGTGCTCATCGGCGACTCTGGCGTGGGCAAGTCCAACCTCG
TCACGCGCTTCACCAAGAACAAGTATATGCCACACAGTGTACAGACCGTGGGCTTCGAGTTCGCGACCAAGACCATTCGCGTCGGGGACCGACGACTCAA
GGCCCAGATCTGGGACACTGCAGGACAGGAGCGATTCCAGTCGCTCACTGCCGCCTACTACCGCAACGCGGTGGGCGCCATGATCGTGTACGACATCACG
AACCGAAGTTCGTTCGAACACGTCACGGGGTGGCTCGCCCAGGTGCACGAGCACTCGCACGAGAGTCTCGTGCTCATTCTCGTCGGGAACAAGTGCGATC
TGGCGCACCTGCCGGAGAGCAGAGAGGTGTCGACGCTCGAAGCGGCGAGATTCGCTGCGAAGCATTCGATGGAGTTCCTCGAGACGTCTGCACTAGACTC
GACGAACGTCGTTGACGCCTTCAAGAAATTGATTGTGCCCGTGGGGCGCCTGCTGTCGCCAACCGAGCCAAAGAAAATCGCGCGACTGCCGACAGGGTGG
CGGCGCGTGCTCTCAAGAACCAGGCCTGGCGAATACTCGTACGAGAACCAGTACACCAAGGAGCGGATCTCGTTCGCACCTAAAGAACCGGCGAAGCCGT
CGCAGCAGAGCTTCCGAGCGTCGAACGGGTTAAAGAGGGTCACCGAGTGTTGTCACCGTCACACGCGAGAGCCTCCAGAGGCAGCATCAAAAGGCGTATC
TCGCACAGAATCAGACACCCCAGTGCGGCGTCTGTGCAAGCAACTGCACTATATTGTAGTCATCGGACCGATGATGCACGGCTTGCCTCCAGGTCATCAG
CCCACAGGCAAACCGTCCTCTTTTTCTCCACCAAGCCAATACAAGTCAATTACAGTCTGCGTGCTGACCCAGGAACGTCGCAAGAATGCGAATGGAGGGT
ACAGGGTCGAATAGAAGCAGGCTCACTCATTGGAGATGTATTTTCTTCAGTATAAGGCTTCGCGTTGCTGCGTGCAGCCGATCGCTGTGGGTGTTGGTTA
GCCGCCAGTTTTGTGCCTGCTATCCTTTCATAATGCTGCCGCACACATCTGGCAATATTAAGTTTACAAACATGATGGACATGGTTGGTTGGTCTCTATG
AATGTTCCCACCAGATAATGCTGCTACTAACCACGCACTGCTCATCGCTCGCTATTGCATCATCCTACTGTTTACTTCGAGCGCCGCGCCACGAAGAACG
CAGCGGCGACGGTCGCAGCAGCGAGCGCGAGAGTGGCGAGCTTGCACTCAGTCGGAGCCGACGTCCACAGCCAGGCACACTCACTGGAAGCCTTCTGGTT
CTTCTTGGCAATAATCTTACGAACGTGCTCGGCCACAGTAGCGCTCGAGTTGCTGGCGACCGATAGCCGTGTAGGAAGCGACTCCAGTGACTTGAGAATT
GGGTGCTGCTGGATCTCCGCCTCAGCCACACCAAGCGCCTTGGACACCACCGGAAGGAATTTGCCGTAGTGAGCAGTGCCAACGACGACAACCGCCGAGT
CGGGCTTGTCGGCTAGCGCTTCCTGGCCGTAGTGCATGGCAGAGGCCGCACCAATGGCGCTGTGCGGGTCGAAGAGGTAGCGGTGCACTTTCTTGTACTC
GGCGATGGTGGAGCGGACTTCGTCTTGGAGCACCGCGTACGACGCCATCTCGTTCTGCGCCTTGGTGAGCAGCTCACCCGAGATCGTGAGCTCGCTGGTC
TGCTCGAAACCCTGCATCCAGCCACGCAGCACGTCGTGGTTCTCACCGGACAGCGCGAAGAGGTAGCGCTCGAAGTTGCTGGAGACGCAAATGTCCATAG
AAGGCGAGATCGTGTGCTCGATGTTGCGGCGGTGGTACTTGCCCGTGGAGAAGAAGCGGTGCAGGATGTCGTTCTCGTTGGTGGCCACAATCAGCTTGCC
AATCGGCAAACCGAGCTTTTTTGCATAGAATCCGGCAAGGATGTCCCCAAAGTTGCCCGTGGGCACCGAGAACGCGACCTCGCCCGTCACGCCCTGCTCG
CGAGCACGGAAGTAGGCCCAGACGTAGTACACAATCTGAGCCAGGATGCGCGCAAAGTTGATGGAGTTGACGGCGCCCAGATGGTACTTGGCCTTGAAAT
CGGCGTTGGCGAATAGATCCTTGACGATCGCCTGGCAATCGTCGAACGTGCCCTTGACAGCCACGTTGTGGATGTTCTCGTCCAGCACCGTGGTCATCTG
GCGCTGCTGGATAGCGCTCACGCGTCCTTCCGGGAACAGGATAAACACCTCCACATTCTCCTTGCCGCGCAAGCCGTAGATGGCCGAGCTGCCGGTGTCG
CCGGACGTGGCACCAACGACCGTGATCTGGTGCTTGGGGGCGCCCGCGGGCAGCGCCTTGTTCTTGCGCTGCAAAAAGAACTCGAAGAGGTTGCCCAGGA
ACTGCAGCGCGATGTCCTTGAAGGCGAACGTGGGACCGTGGAAGAGCTCGAGCACCAACAGCTGGTCTGTCACCTTGACCACGGGCGCCACGTCCTCGGC
GCGGAACGTGGTCGCGTTGTAGCTCTTGGCCACGAGCGAGCGAAGCTGGGCGCGCGAGATCTCGCTCTCGTTGATGAAGAGGCCCATGACCTCCACGGCC
AGCTCCTGATAGGAGAGCGACGCCCACTTGGTCAGCGCGTCGGCCGGCAGCGTCGGGAATTCGTCGGCCTCGGGCACCAGCAGGCCGCGGTCGGCCGCCA
GACCCGTGAGCACCGCCTGCTCAAAGCTGAGACCGCGGACGCCGCCGCGCGTGCTGCGGTAGTGCACCATTGTGTGTTGGGTTGGGTTGGGTTGGGTTAG
TGAGAGTAACGCGGCGAGAGCGCAAGTGACGCAGATGAAGCCGCCTGCTTGGGCTCGGGAAACTTCTTGTGCACTGGAGGACGCAGGGCCCCGAAGTTTC
GGGTAACATTTACCGTTGTTGCGCAAACATGCGACGTGGCGCAGATGTTGCACGAGGTGTGGTGCACACCACTTACGGCAATGCTCATGAATTTATAGCT
CAAGTTAGTGCTGACCGCTACCGATTTACGTGTCTTGATCTGCCATTTGACAAGGAAGATGTGAATACCATGGACACCTGCATTGCCTAATCGTGTCGGT
TCGTCGGCTTCGCTCTCCAAGACATGCAGAAAAGAAGCCGGCACATCTTCAACGAGAAACCGGGAGAGCAACAGCCTGCTGGATAATAAAAAAGCAAACA
GGGAAATATATTTCGCATGAGTACTATCTCCCCGGGGTGTTCCACAGACTTCTCCTGCCGAGAGCTTTCTTTTCGTCCGCTACCTCATTGGAATCCGCCT
TCCGTTACTCTCTACCTCATCGCTCGTGATCGCAATCAGTTCTGGCCAAACTGGAACATGGTGGGCTCGTTAGAGGACGTGCCGAACTGGAACTGCTGTG
CGTTAGCATCCGTGTCGGGCGCTAGGCTATCCTCCGCATCCTCCTCGCCGTTGAAGAATGTTTCCACGATCTTCATAGACTTCAGGTAAATGTCTGTCAT
CGGCACGCAAAGCAGTTAGTAAGCATGCAAGGCCGGACGACACAAGGTAATAAATTACCTTCGTTGGCGTGGTACTGCAGCGCCTGAATCTTGTTCACAC
CGTCCGCCTCATCAATCATCGTTGCGATGTCGTTAACGTCGTTGGTCTTCTGCGCCTCGCCCGCACGCAGAATGTTCTCAAGACCCTCCAGGGCCACAAT
CACGACCTTCGCGTCCTTCACTTCGAGCAGGTCGCACAGAGGCTTGATGCATCCTGTACAAATCGACGACACAAGGTACTGTTAGGTACAGCAACCCAAC
TGCAAGTGTTCATTTCACTTACCGAGGCTGACGAGGTGCATGATCTGCTCCGCCGAACCTCCCGAAGTGGCGTTCGACACGGCCCACGCTGCCTCCTTAC
GAATGTCGAACTCAGCCGTTGACAGGAAGTTGATCAGGGACGGGAAAATGTCGGCCTCGATGATGAACTGAATCTGCTCCTGGTTGCCAGCCGTAATGTT
GGAAAGCGTCCAACACGCCTCCTTTCGGATTCCCTTCTTGGGGCTCTCCAGAAGCGCACGCAGACACGGCAGCGCGTTCAGGTTAATAATCACCTGCGTC
TGCAGATCGTCGCCCGTGACGATATTGCCGACCGTACGCAGAGCAGGCGTCTGCACAGAAGGAGAGTGGTGCATCAGAAGCTCCACAATTCGCCGGCACA
CGCCAGCCTCAATCACCGCCTGAATCTTCTCGTTCGAGCCGTCGGACAGGTACGACAGAGCCCAGCAAGCGTCCGTTAGCACTTCCTCGTCGTGGGTGTA
GATGAGCTGGCCCAGAGTCGGGAGCGCAGGCGACACGAGATCGAACTGCGGCTGCGGTTTGCCACGGCAGAAGTTCGACAGCGTCCACGTAGCGTTGCGG
AGCATCGTCGGCTTCGAGTTCTCCCTGAGCTGCTGCATGAGCGGACGCAGCGCACCGCAACGCAGCACCATGTCACGGCACTCGATGGAGTCACCGGCGA
TGTTACCAAGGGCCCACACGGCCTGCTCACGCACATCATCGTTCGTGGACAGCAGCAGCTGGCAGAAAATAGGCACCGCGCCGTGGTTGATCACCACCTC
AGTATCCGCAGAGGTACCCGAAGCAATGTTCGTCAAGCCCAGGCCGCCTCGAACTGCAGGGTTGGGAAGTCCTCGCGCTGAAGGAACTGCACAAAAATGG
GGACGACGCCAGTGTCGATCACCTCCTTAATAGGCGGGTTGCGCTCTGCGATAACAGCGTAAACAGGTCAGTCAGGTCTTTTTTTGCCACCTCGCACTGT
AGTCTCTAAAGCTCACCAATAGACAGCAGCTTGCGGAACTTGGTCACCGCCTCGAGCTGCACGTCCGCGTCGCTGGACTGCACGCCCGTCACCATCTGCG
GAAGCTCTGACAACTACACAACCCACCAAACGACTCACAAATCAGTGCGCGCCTTCTCACTGCGCATCCAGCGCCTGCTTACCCGCTGCATTAGCGATAA
CTCTCCGGCGGCGTCTCCCATACCAGTCGTCGCCGCAGATCCGCTGTCCCCAGGCGTCTACATGGCAGCCACAACGAACAGTGAGTCTTCTCCAATAAGA
TACGAAAACGTCTCCAGGCTACGCCTGTGTCTTCTACTACAAGGCCACAAGCCGATCGACAAGAGAATCCCTCTGCCTCTTTCGGTTGCTAAGCGTCTGC
TACTGCTATGCGTACCATGCGGCGGCGCTGGTTCATGCGGTCCTCCTTGATGGTCTTGCGGATCTGCACGGTGGTCTCCATGCGGCTGCGACGCGACTCA
TCCGAGTCGATGCCTTTCTTGAAGAAGTTCTTGCGCTCCGGCGCTTTTCCGGCGGGGAACGACATGGTGCTCGGATCTGTGCGTGGGCGCGGCGGGCGGA
TCGGGACGCAACTAGCGACTGCGCGGCTTCTTTCCTTGTTTCCCCTTCTCGAAAGCGCGCGGTACTGGCGTGGACCACACCTAGCTTTTTTATTGGCGGG
CCTCGCACGACTTTTCGCAACGGAAATGATTGGCATATTTGGCCGTGTCTATTCTTTTTAAAAGAAGCTATCATTACGATACGCAGAGCGGTAGTACACA
GAACCTGCGAAAACGAATAGCCAAACGTCACGGAGAGGGTCGGACCTTCAAGCCCCGATGATGAAGCCCTCAAGCAGACCGAAGCTGTTGCCCGCCACAG
ATGCGCCCACATCGTCGTCCTCCTCCACACGCAGCGTGGTGATCCACGTGTTCGACGAGTACCGCAAGAGCAGCAAGGAATTCCAGTGCCAGCGCGACCT
GCTGCTGGCCAAGATGAAGTACTTCCAGGCGTACCTGAACGAGGCCAACGAGCACGACGAGATCGACATCTCGGTGCACTGCGACGTCGAGATCTTCGAG
CTGCTCATGGAATACATGCACCAGCGCGACCACGAGTGGCGGCCGCGCATCACGCTGGAAAACATCGCGTCCATCCTTGTCTCGTCCGAGTTCCTGCAGA
TGGAGGAGCTCGTGGAGGAGTGCGTGGCTTTCATCTCCAGCCGCGTGCAGGACTTCATGCTACTGCGCGTGGACTTTGGCTGCCTGTCCGACACCACAAT
CGCCAAGATCGCTAACAACTGCACGCCCGAGCAGCTCCAGACGCTGCACGACCCCAAGGACAAGATCCTGTCCAAGCTGCGGCGAAAAAAGGTTGAAGTG
CTGGTGAAGACGCTGCAGCACAGCGGGCGTCGCATCGAGCTGTGTGCGCACTGTGAGCTGCTATTCATTAAGGACGATAGGGGGTGTCTAGGATGCCAAA
AGGGTAAGCGCCAGATCGGCGTGCATGGCGAGCTGGTCGGAAAGCACCAAGCGAAAGCAGGGTGGCAGGTCGAACTATTCCTACGCGAGCTTGGCATCGT
CAAGAGTATTTCGTGGAGCGCGGTTTATTGGTACATCTGGGGCTCTACCAAGTACTTCCACTGCAGCGTCTGCAAGCAGAGGTGCAGCTTGCTTGAGCTG
CGTAAGTGCGCCTATCACCCAGGCTCGATCGTCGATTACGGCCCCGCTGCCAAGTTTTCCTGCTGCAGCGCGAGGATTTTCAGCGCCGACGAGATATCAA
TGCGCGGGTGCAAGGCCATTGCCCACGTTCCGGTTCAAGGCGCCGATAAGCACGCAGACGTTCGCAGCTTCAGCAACGTCGTGGCGCTTCCCAACATGTG
GGAGCAAATCCACGCGTGTGAGAAGGTAGCGACGGCCCAAGGCCCTCCACCTATCGGAGACGCAGGCGGCGGCGGAAGAGTTGACGTTGCCTTGCTCTTT
CCTCCGCCTCAGCCGAGGAAAAATAGCTCAAATGCTGTGGAGCGTGAGCCATCGTCCAGAAAGCTGAACTGTGCAGGCGAATGCAACTCGTTGGGCTACA
GGAAGCAATGCAAGGTGCTGCAGCTGCAGGAGAAGGATCGAATTCGCTGCCAGGACATCGCGCGGCAGCTGGTGCAGCAGCGCCTAAGGAAATCTCGTCT
CTTGGACCTATAGCGCCCGCAACCGCGATGAAGGCAACACCGCTTGGGCTCGACGGGGTTAAAAGAGGATGTTCTTGGCCCTGTTGAGGTATCGGTCCAC
GACCGCGCCGCATAACGCGCACTTGTACACCTCGCTGCAGTGAGTAAAACTAGCGGCCTCTCCATGGTGGTTGGCACGTGCACCCCCAGGTTGCGGCGGC
GGCAATCTCCTGTTGCCAGGAGCGGAAAAAGGCAACTCGCATTGTACCCCGTTACGGGTACACCGCTACACTGCTCCTGTAGAATCAGAACGGAATCAGC
TCGGTATGATAAGCGGTTGGCAGTTGGCAGCCTGAGCAGCGATGTGGAAGCGACCGCTGCGCGACGTGGTGGTGCGCTGCCATGTGGGCAACTTGCGCGT
GTCTGGGGTGATGGCACGCAACGCAGTCGACGAGGTGGCACGACGGTGGCGACTGCCGCTTTCCTCCGAAGGGACGAAGCTCTGGGGAGAGTACATGGCC
GGCACCACCATGCTCAGTTCCTTTTTCAAGGGCGAGGAGCGCGTTAAGATGATGGTCAAGACGCCCAACATCCAGGAGCTCTACGTCGAGGCCATGGCCG
TTGGAGAGGTGCGCCCCCACAGTATTATTGAATGGCATAGCAGTGTGCAGTAGCTCAACGACGTGCTCATTGGTTGGTTAGGTCCGAGGCAAGGCTATCT
ACGTGGACCAGTCTCTCGCTGGCGCGCTGGAAACGGGAGGGCACATGCACGTCTCTAAGATTTTGTACGGCGCGGCCAAGCCGTACAACACTTCTATCGA
GGCGTCCGGAATGCCGGAGCTGGACTGGCAGAGATTTTTCGACGTGTCAGAGCAGGTCCCGACCATTGTGCGTATCGATAGCGAAGCTGCCGACGACCAC
ACACGTAGCTGCGGACTCATCGTCCAGAAAATGCCGCCGACAGAGGCGCATGAGCGCCATTACGAACTAGAAGAACTGGCCTTTGACAAGCTCCCCTTCT
TCGCTTCTGAGTTGAAGAAGAATACGGATCTGGTCGAGTACCTGAACGAATTGATTCCAGGCGCCGATATCACGGACAAGAACTGCAAGCGCATGCCACT
GGATTACTATTGTCGCTGCTCCAAGGACAACTACGCGCAACGACTCAAGGACATGGGCGCAACAGACTTGAAGCAGATTGCAGCGGACGTGGGCAGCGCT
GGCGTCGATCTCACCTGCCATTTTTGCAATGACGCATACCACTTTTCTTCTGGCGAACTGGAAGGTCTGATCGAGTCGCTGCCGAAGGCATAATCAAATA
CGCTAAAGCAACGAGGTAGTATATCGACATGGTTATAGAATATGACGAAGTCATCATCTATGCGTTTGCCTAGCCCTCCTGTCCGAACTCCTGGGTCCAC
TTCACGAATTGGCTGAGCTCGTCCGAAGCAACAGTAGCGGTAGAATGCTCCAGCACGCGTGTAAAGTCACTCTGCAGTTGAAAACAAGACGACACGAGTG
AGTCAAATACTAATCAAGACCACATCCAGAGCGAAGCAGACCCTTACCATTGAGATCATCGGCGGCCGCAGCTTTTCATCCGAGTAGCCCCGTTCTGGCA
AATCGTACAGACGCATGCGTAGCGCACCGCAACGTCGACATGGTGCCTTGCAGTCCGGACACTTCGGACGGCACGTAGAAAGCTTCATGTGACAGTATGC
GCACGGTGGGTCACCTTCACAGGGTGTCAAGAACGGACCGTTCCGAACGGGGTGTGCCTTATCATTGCACTGCAAGTAATGAGATTTTTGATGTTGTCAG
TAAACATTCACACCAAAATCGGATGAGTTACCGCATCCTTACCGGAGTAAAGAATTGGGCTTGTTGGCACTTCCGGAGGGGCTCCATTAACGCATCTCGA
ACAAGCACCGAGATATCTGAACCAGAGCAACTAAGAAGATGCAAAACAAATACAGTAACTAATATCAGCTCGATGTTCCAAAAAACACCTTGGTGTTGCA
ACGTACCCGTCTGTTTTTTCCGCAATGGCAGTGAAGTTTGAATCGCTTAGCTCATTCGGAGTATCGCCCAGGTGGATTCCTAGCATGACCTTGCGTGCAT
CCGTGTCAGGAAGAGGGATGTAAATGCGCTTCTCAAATCTGCAGACAAAAGTTCAATGTCAGCTATCCGCAACCAGATGCCTGTGCTTCCTTCAAACAAT
CATATAAAGTAGTACGGATTTACCGTCGTCGCATGGCTGGATCAAGCTCCCAGGGTACGTTCGTTGCCCCGAGCACCAGGACACCGTCATGATTGTTGCC
CATACCCTGCATTTGTACGAGGAACTCATTCTTGATGCGACGCGTAGAGTCACTCTCGCCCTCGGATCTGCTCGAGCACAGCGAGTCGATTTCGTCTATG
AAAATGATAGCGGGTTTCTTCTCGCGCGCCATCTCGAAGAGGTTCTTGACAAGCCTGCACGACAGCGCATACATCTTATTTCAGCTACAGCAGCTCAAAC
TCGAGTTTCATCACGCCAATGCGAATCATACTTTTCGCTCTCGCCTTGCCACTTGGAGACCAGACTGGAGGATGAGACGGCGAAGAACGTGGCGTCTGCT
TCCGTTGCGACCGCCTGTGCAAGGTACGATTTGCCTGTACCCGGCGGCTACATCAATAAACAGCTTAGTGTACACCATGCTTCCCGACTTTTACGGCAAT
CACTCAAGAGCGCACCCCATATAGCAGAATGCCCTTCCAAGGACGGCGCTTGCCCGTGAACAGCTGGGGGAACCGTGCAGGCAGAATCACTGCCTCTTTC
AGCGCCTCCTTCGCAGCATCCAGTCCAGCAACGTCGTCCCATTTCACATTAGGCTTCTCCGTCACAACCGCCGCTGCACAGAATCGTTCAGAATGTGCAC
ATCAGCCACAGCAAACATGAAGAACCCATACTCGGAATCCTGAGTTACTCACAAGCCAGGGAACCACGTAACTTGGCTGTCTCTGCGTCCGTCTCATCGT
CGTCTTCCTTCTCCCCCCTATACACAGCAGCAACCTCAGTATCAAAACAGCACCAGCACAACTTGCACGGCAAACAAACGTACTTGTCCATGTCCACGGC
GGCGGCCACCGCCTTGGGCGCGTTATCCTTCTCCAGCATCCCCCGTAGCTGCTCCGCCCGCGTCATGTAGCCCTCCACCCGCTTCATGATGATCTCCTTC
GATGTCGGATTCTTCTCGTCTGCAGGGCAAGAGTCAAGTTAGCTGCATTGCAACATTGGAAGTCGGCACCCGTACGCCTCCTCGCTGGAGCTTCAGACGT
ACATTTGACGCCGACCATGAAGTGCTCGAGTGCCTTCTTGTACAGGCGGAAGGCCTCCTGGTAGTTTTGCTGTTGTCCTCATTGATGGCGTGCGTCACGA
TCTCGATCGCCTGCGGGATGAACTTGTTCTCCATCGCGGCACCACCTGATCAATGCGGCGCAAACTCAAGTGTAACATGTAAGAAAATCCACGCGACATA
CCATAAGCCAAATTCCGTTTGTTTGACATATCATAGGCCAAATTCTAAAGAAAAATCGCAAACTGATTTTTCCAATACAATATCTCTGTTGGATTATCCA
ACAAGATCGGATGAAAGATATCTCCATGTAAAGGGTCATCCTGCTGCTTCTAGCTGCAATGGGCGTGAGCCAGTCGAAGGGCGGTGGCGCCGTGGGGGTG
CGTTGGAAGCTGCAAACGCTGGTGCCTCGGTCGTGGGGGGAGCTGGAGCAGCTGCATCTGCGTTTCCAGCAGGAGGCCCACCGCCGTCGAGCCGACCCCG
TGTTCCAGTACTTCCTGCCGTTTCCAGTGTTCCAAACTATCGTGGCGCCGCTGTGCCCCGACAAGGACAAGCTGCATCTGCTTGCCATGTTCGAGGCACT
AGATGTCAAGACGACGAGGAAACTGGCCGTGATGGACTTCTTCAGTGGGCTGGCGCTCTTGGTGGATGCCAAGAAGCCTCAGAAACTCGAGTGTGAGGCG
ATGCACCGGGCGGTCTAAAGCACTAGTCCTAGTGAGGGTAGCTAACTCGTACGCGTGGCTCCAGTTGTGCTGTCACTGCTGGACAACGGAGGCCTGAAAA
CGCTCAACAAATGCGAGTTGACGATGGTCGTGTCTGCAGCGGCCAGGGGATTGAAGATGTTCGCGCCTGAAGCAGACGTCTTGCAGGAATCAACCATGAG
GCCGCTTATTCGCCGTAAGGACTGCGGCTATGATTTATGCACCTGTGTCAGCTTAGCGTGTCTGCTTTGCTGCAGGTCTGTTCGGAGACAGCAGCGAGGT
TCTGCGGCAAACCATCGTCAATAAAGCTCTCGCAGACCCTGAAATCCTATTTTTCATGAGCGATCTCGAGTCGGTAAGTGTCTATAGTTTGTAAGCTTGC
TCAATAGCGCTTGCTTGGATTTTATTTGTCTGTACTGCATGCACAATAGGGTGTAGCGACGTCCTCCGATGAGTTGCTGATTCAACAGGGAAAGCTCATG
AGACATATGGCCTACTTGGACTATCAAGCCGCACGCGTTAAAGCGTCAGGTATTTCAATATTCTTGAATGTATACGTCAATGGAGTCCAGCTCATCTTTT
TTGTCATTGTAAGAGGAGCGAGGAAGGACATCAGCGGCAACTGCTCCCATGAGTGGAGTCGGTGAAGAAGCCAAGGGCCAGCAAGCCCTGACAGTGACAT
TGGTCCCCACAGCAGAAAGTTTTTCGCGCAGACTTCAGAGTATTGTGTGCCCACCCCCACCAAATGGGTCAGACCAGTCAATGCGCGTGCTATCTGCAGT
TGAAATTAAGAAGCATGTTGACCCACGCACACTCCAGCGGTTGGTCAATATTGTTTCAGATGGCGGTCTATCGCTCTCATGGAAAGAGGTTGATTTGCAC
GGCAAGTATCCTACCTTCATCGAAAATACTGATTTATGCATTGCTTGTCCCCCTTCAGGCTGAAGCACTCTTGGGCGATATGACTTCAGACCAGTTTGGG
CTTGTACGGTGCGGCGACATTCTGCGCGTCATGAAAGCTTGGGTACAGAATCGACGACGAGAGAAACCAGAAGCACTGTGGGAGTTTGTGAGCAGCTACG
TGGCTGACGGTGTTAAAAGCATCGAGAAGCAAATGAATGCTGTTCTTGTTGCGATTGTCAAAAGAGCAACGAAGGCGCTGGGGCCTACTGTGCGTCAGCG
GACGGCTGTAGCTAAAGAGCATTTGCTTGAAAGCTTGCAGAGCGTCGCACTAAACCCTGATACTGACGATGGGGAGCTTCAGTGGAGTCTCAGCATTCGA
GTTGGCGAGACTGGTCTGTCGGTGCTAGCGCCAACAAGCTCTCCGCCTTCGAAGCGTCTAGGCGCTCCTTTAGGAAATAACATCAGATTTCGACTAGGGA
TTCATCCACCGAGTAGTGCAGATGGTGATATCGGTGCTAAGGCCAAGTTCGAAAACGAAGGGCAAGCGAACAACGACAGTGACGAGCTAAAGGATATTGA
TTCGGAAACTATGCGCCTTTTTGCCAACTTCTTACTAAACCCCGAAATCACAGGTAAGGACCGCCGTCTTGATTGCGCTGTGTTTTTTTTAAACCCAAGT
TCTATGCTTGATTAGATGAAGAAGGCATCAACGTAGCATCATCGGTAGAGAAGGCATTGCAGCAGGAGCTGGTCTGGTCATCATTTGCATCTCTATGGAC
GAAATGCTCGGGTTCGGACTTACGATACGGAACTGTGACGGGGCTATGATGTGGGCTAACCTACTTGTATTTTGTATAATTGTTGTAGTTACAATGCATT
CGGCAATTCGAAGTGACAGAGGAGGACAACCTGTCCTTGACCAGTATCTTCGCGTCTGTATCAACTTCCGCGAGGACTTTATCTCGAGTGTGGAGGTAAG
CTACCGCGCTGATAAGCGTGAGCAGACAACGTTTTGGGCGTTGATATTCACGTTATATTCATTGCGCAGGAGTGCACAGGTACATCGTTCGCGGTTGGAA
TTCGTAGCTTCTTTCTCTTGGTTGAACTGGAGCAATCTTTGGTGGATATTGTTGAGGCTTCACTGGATATGTCTGCGATGCTTCACAGTCTTGGCAAAAG
GCAGAATCGACAACGCGCGATGAGGATGATTTTTGATGCATTTGATGCAAACCATAGCGGCGAGTGGAGCCTTCAAGAGTTCAACACTTTCCAGCAAGCA
CTTGGAAAGGAAGCTCTGCTTGAAATCACCCTAGCGGAGTTGTTTGGCGGATCCTCGTCGATTTCATTCGACCAGTTTGTTACAATCTACGAAAATTACC
CAGTCGCCAAACTACTCGAGATGATCCGTCAGCTAGAAATTGGTAGGGGTACCTATTCGTGGTGGAACGTTATGGATTGCTGTACTCATGACGATATTGC
TGCAGGCTCGCTTGGCAACATGATAAAGGGTTCCGTATCAATAACATCGACACTGAATGAACCATGCGTAAAGGCTCTGGGCGTGTTTCTAAGCCCGCTG
CGCTGGGCTGACGCGATGTGGAAAAAGCTGCTTCTTTTCTCTAGAAGCACGAAGGATTTAAACCTCGAGCTTCAGTTTTCCACGCTTTCGGATCTCCTAC
AGAAGAGCTCTCGTCGTGTCGGAAAGCTGGATTGTATCGGGGACCCACTGTTTGTAGCATCATGGATGAACTGTCTGGAGGAATTTGTGCAGCCACCACA
TGCAGAGCACTTAAAGGATCGACCATGTCGAAGTATCTTCTGTTCGCTGGAGAGTGAGATAAACAAGACGGAGCAGCAATGGGAATTTGAGGACCAGAGT
CGGAAGCTTCCACGGGGTACATCTGCTCGCCGTGCCGAAGCCATGATTCCAATTCTGGAAATGGCAAAGCTTGTAAAAGTGCACGTTAAAGGACTAGTAT
TGTTGGAAATGCGTAGCAAGAGCATTCGGATTGTGTGCGAACTTGACAACCTCTGGATGGCGCGGCCAAGCAACAATAATGAAGAAGTCGACACTGGAAG
AAGTTGACCTTGGGTAACGCTACTTTTATATTTGCGAGGTAATAATAGGTCATTTTAGTTACGTGTCGACGTGCTCAAGGCGAGAGCGATATGATTCAAA
GAATACTTGACCTCGCTTGACCCATGAATCGTCCAGTGACGGCGACATCAGCTCACAATGATGAAGGGGGCTTGACATTTTCAAGCGAAGAGTCCAAAAC
TGCGTATGCCCAAGCACTTGAAAACCGGCATCGTGGATTGTACCAAGAGGCCGTCCGAACTGGAACAGATCATCGAGGTAAGTGTGACAACGCTCGGCCC
ACGAAGAGTGGCGTACTAACACGTATTTGCTGGCAGCAAGAAGGCGACTCCGAGAAGCTCTGGACTGAGCTCGCACTTGCACAATTCCAGCTTTGGGAAG
CGCATGTCCGAGCATTACACTTGCCGTCCATTCTAGTGCTCACATCAGCAACGCAATCCAAACGACCCACAAGCGCCAGAACCGACACCAAGCCATTGCA
CATGGTGCTGCTTCAAGAAGTCTACAGCACCTTCCTCATCGCGATGGAATATCCAAACAGCAAATCAAGCCCAGAGCTGTTGCTCCCACTGGTGCGGCTT
TACATCGAGTTTGGGTCGCATCGGGGTGCACTCGCCGTCTGTACACTGCTGGTCGAAGGATATTCAACGTCTCCACGCCTCAATGAGGCCATTTTCTTGT
CGGCACTTACAGCATCGGCACTGGGGCGCCACCGTGAGAGCGCACAATATTTCCAATACCTAGCGGAGGGGCCGGGGCCGTCGTCATCGTTCCCGTATCG
CCTTGCTGGCTATCAACTGAGCCTGCTAGCAGCATTAGAGCTAGCCCGGGTGCCAGGTATGCGCGCACTGGAGCGTGAGATGTATACCCAAGCGTACAAA
GCTTTGGTTGTGCTTCCACCAGTACTGCCATCGGAGAAGACAGCCCACACGTTGTATACGACATCGAGAAAAAATGAGGAGCAGCGAACCTTACTATGGT
GTCGCGACGTGCAAACATGGTTAGACCTTGCTCAGAGACTTGCTGGACCAGCCAATGCTCCGCTTCTCGTTCTATTGGCAATTCGTGAAGCGCGGCGCCG
GTCAACAGGAGTAACAGGATTCTTTCCTACATCAAAGCTGCTACTGGAAGGCGTTAGTCTGTTGAGGACGAGAGACAGCTTGGGTGCCGAGAGGGTACTT
GGTGAAGCGATTTTGCTGCTACCTCGTGATACATACTACAGCGCGCGGCACGAACGCTTTTTACTGGAGCTATGCAGTGCCTCCTGGCGTGCACAATTCG
CCTTGGAGCACAAGAGTGCTGCACGTCTACAAGTATTGCATCGGCGCCGCCGTAAATTAGCGCAGTGGCATCTTGCTGTCGCTCATGTTCTGGAGCAGCG
TCGCCATGCCATGACGTTGCGCATTCAATGCGCATGGCGGGGTTCATAGCAAGACAGGAGCTTGCATCCTTGCGTCGAAAGCAACGAGAGAAGGAAGCGC
TGGCTAATATGACCATGGGTGTGCACGACGACAGACTCATCGAGCTACGACTGAATGCAGCCGCAAGGAAAATTCAATCTCTGCTTCACATCGCGCGAGC
AAAGAGGACGATTCGAGTCCTGCGAGCCCAGAAAATCGAGCGACAAGCTCTCCTGGCAAAGTTTGCTGGTCGCCGGACCGAACTCGGTCAGCTTGGTGTA
TTTCGTAGATGGCGAAGCTTTGCTTCAACCCAGAAGCAAGAACGCCTTGATGCGGTCGTACGAATTCAGCGCCAGGTTCGAGCCTGGCGCAGCCGCAAAC
TCTGTTTTCAGTTGATATTGCTTCGACAGCAGCAAAATAGTGTTTTGCAGCAGTGCCTGGCACGGCGCTCGACTTCGCTCATTTCACGCGTGCTGAAAGC
CTGGCACACGGTGCTTATCGAAGCTAAGAGTGAGCGAAACTGGGCTTCACGGCTGATTCAACGCAGATATCGTTCAAGGCTAGCAGTACGCCAATATCAT
GTTGAGCTGCGGCGGCACCGAGCAGCAACCACCACCATGAATCGTATGCTTTTAAGTCGCACGCAGCAAAAGCTTTTAAGCTCATGGCGAGCCCTCGCAA
ACCACGCGCTAATCCGTCGTCTGCGCAAGCGCGGAGCTGCTGTGACTATCCAGAAACACATTCGAGGCGCACTTGCCCGGCGACAAGCCAAGCGCCTTCG
TGCACGTCGCCGCCGAGCACTCAAAGTGCTCGTAAAGCTCACACGCTCGCGCGAAATACAGCTTCAACAGACAGGATTCGATCGGCTTTGTCTACATGTG
CAAGAGCACCACAGAAGAGCACATGGCGCAGTGGTATGCATACAGGGGCTCATTCGGGGATTCTGCTGCCGTCAAAGGCTCCATCGACGGCGTACGGCGG
AGATGCTGGTTCAAGGGAGCGTCTTCGGCAGCGCGCTTAAAGGGCAGCCAGCAGACATCGTGCTATGGGCATGCTTGATGGCGCTGTCGCGATATATTCG
ACAACGAGATGCCGCAGTCGTTCGGCTTCAACGATGGTGGAAACAGCGGCAAAAGCGTGCTCGAATGATCCGAGTATTGAGCAAGCGTGCAGCTCAGCGT
CACCTACTCGGCAAACTGCAGCAGAGTTTCTACACAACTGCAAGGAGCTTCCTCCGGGCGCTTCAGACTGCTATCAACACCAAAAAGGCCCGAAAGCACT
CGGCAGCGACTAAAATCCAACGACGGCTACGATGCTGGGTGATGCGCCGAAGGTACCTTAGTACTCTTGATAAACACTCAGTCGCTGCTCAACGTGGTGA
GAAAGCAGCAAGAAAAATAGCGCTCCAAAGAGTACGCCGCTTGTATCATGGCTGGCGGGATGCAACGCGGAAGACGCGACAAGAGCAGCACGAGGCAGCT
TGTCTGGTACAGCGAACTTTCCGGCGGCACCGAGCGCAGCGGCAGGCACGTTGTGTTGTGGCAAAAAAAGCAGCACAAGCACGATTGCTGGCTGCAGCCT
CACAAAAACCGTTGGAGCGCTGCTTTCGTCAATGGGAGGCCACAGCCCTGCTCGAAAAGAGTGTGCTGCGTGTGCGCAGTTCGTCACTCATCGGCTCAAG
AGAAAGCACCCCCGTGAGCGGCCAGCGCAAGCTCGAGATTTCTTCTGGTGGTAGGTTCGACAAGACTCCGACGCTTGAGGAGGTAAGCTGTTGGCTGAGC
TCTACAAACGTGCAGCGTACGCTAACCCACCAATGTCTCGTGCTCAGCGCGCCAAGATACCGTCGATGCTCTTTTTCACGGTACTCAACCGTGTGCGTCA
GACCGGGATTTGTCAGCTCTCTTACAGGTACGCCTTGTCGAGTGCACTGCTGTTCACACAGGCAAAAACTCACTGCTCACAATGTTTTGAATTTTCCAAG
CGGCGGCACCGTGTTCAAGGGTCCTCAACTGCGGCAGTTGATCTCATTGTCCACCAGCATAATCGTCGACAGCGGTGGCGGTCTCTCCCAGCCTCCTGCA
GCTCTCTTCTCAATCTCAACGAGCAGGTCGTGGAAGCTCTGGAGGTGTGCTCCAACTCTGGCTCGGGCTGTCCAGTTCAATCGCTCATCTTGTGCAATGC
GCCGCTCCGGTCCCCCCACGCGTCCCTGCTAGCCACTGTATTGCAGCGCAGTCGCAAAAGTTCCAACCTCGCTCTGGTTCCGTGGTGCTTGCCAACGTCC
CTCTCGCGCTCACGTCCGTTGTCTCTCTCGCCTGTGCGCTGGCTCAAAGCCCGAGCTGTCTGCAGCAACTGGTGCTCGAGCGCTGCCAAGTGGGCAGCGC
CGGGGCATCAGCTTTGTTCGAGGCGCTGACCTACAATCGCGCGCTCTGGAAGCTCGATCTCAGCGGGAACCACATTGGAGACGCCGCGTGTCCCGCTCTG
GCCCGCTCCCTCCTCGCTGGCAGTGCAGTGCGCGTGCTTGCGCTCAGCCGCAACTCGCTGTCCGACCGGGGTGTACTGGGCTACCTGTCTCCCGCATTGG
GATCATCACGATTGGAGACGCTCGTGTTGCTGCAGAACCCGCGGGTGTCGTCTCTGTGCAGCGCGTCGCTGCATCAAGCTGCTGCGTCCTCTGGAGATCT
TATTCGCGTCCTTTCGGACGGCGGGTTGTGATTGGCAGATATCATGGCTACATGTAGCCATGTTGTCACCAAGAGCGTGCTGATTGGCTGAAGGCTGGCT
GGACGGAGAGCACCCTCGGTACCCTGTACGTCAGTGGATGGTTCAGCAGAACCGAACACTCCGAAGCCTCCACCCGACTCGTAGCACCATGGTCGACGCC
TCCCCCGTGACCAACCGCAAGCAGGTGGCCATCCTGGACTTCGGCTCGCAGTATAGCCACCTGATTGCACGCCGCGTGCGCGAGCTGCACGTGTTCTGCG
AGCTCTACTCGTGCCTCGTGAGCGCCGAGGAGCTGCGCAAGCACCAGCTGACGGGCATCATCCTCTCGGGCGGCCCGCAGTCCGTCTTCGATGAGGGCGC
GCCCCACGTGGCTCCTGAGGTGTGGCAGCTCATTGAGGAGCAGAAGATCCCGGTGCTCGGCATCTGCTACGGTCTCCAGGAGCTGGCTTTCACCTACAAC
GGCAAGGTCGCGCCCTCGCAGCACCCCGCGAGTACGGCAAGGCCATCGTCAGCCGCAAGAACGGTGTGGACTGCGGTGGCCTGTTCGAGGGCCTGCCCGA
CGAGTTCCAGATGTGGATGAGCCACGGCGACAAGCTGCACGCGCGCCCCGACGGCTTCGTGGACATCGCCACCACCGAGAACTCGGAGCACGCCGCCATC
GTCAACGTGGAGCGTAAGTTCTACGGCATCCAGTTCCACCCTGAGGTGACCCACAGCCCGCGCGGCAAGGACATTTTGCGCAACTTCGTGGTGACCATTT
GCAACTCCCCCACGGACTGGGACATGCGCAGCATCGCCGACGCCTTCATCGAGGAGGTGCGCGAGACCGTCGGCCCCGACGGACACGTCATCGGCGCTGT
GAGTGGCGGTGTGGACTCGTCTGTCGCTGCCGTGCTGCTGCAGCGCGCTCTGGGTGACCGCTTCCACGCGGTGCTCATTGACAACGGTCTCCTGCGTAAG
GACGAGGCCACCGAGGTCGTTGACCGTCTGCAGACCAAGCTGGGCATCAACCTCAAGTGCATCGACGCCTCAGACCGCTTCCTGGCGGCCCTCAAGGGTG
TCACGGAGCCCGAGACCAAGCGTAAAACGATCGGCAACCTGTTCATTGAGCTGTTCCAGGAGGAGGCCGAGCGCATCGGACACCCGGTGGACTTCCTGCT
GCAAGGCACGCTGTACCCGGACGTGATTGAGAGCGTCTCGTACAAGGGCCCCTCGGCCACGATCAAGACGCACCACAACGTTGGTGGCCTGCCTGATACG
ATGCACCTGAAGCTGATTGAGCCGCTGCGTGAGCTGTTCAAGGACGAGGTGCGTGAGCTCGGTATGGCTCTTGGCATTGACGAGCCCAGCGTGTGGCGCC
ACCCGTTCCCTGGCCCCGGCCTTGCCATCCGTGTGCTCGGCGAGATTACGCCCGAGGCTCTGGAGACTCTGCGTCACGCTGACTCGATCTTCATTGAGGA
GCTGCGCAACAGCGACCACTACAAGACGACGGGCCAGGCTTTCTGTGTCCTGCTGCCGGTCAAGTCTGTCGGCGTCATGGGCGACGGCCGCACGTACGAG
AAGGTTGTCGCCATCCGTGCCGTCAGCACGTCGGACTACATGACGGCCGACTGGTACCACATGCCGTACGAGGTGCTCGGCCGCATGTCGAACCGCATCA
TTAACGAGGTGCGTGGCGTGAACCGCGTCGTGTACGACATCTCGTCCAAGCCGCCTGCCACCATCGAATGGGAGTAAGCGGTATGGTGCACTCCTCGTCT
TTGCCACCATTTCTGCAGCTCCGCTCTACAGGGTTACTAGGAATACTACCGGTAGGCAACGGCGGAGGAAGACACTACCCCTTACGGTAACGTCGCGCTA
ATAGAGCAACGATACATGCGTGTACACTAACCAAGATCAAATGGAGCAAAGCGGCAGGCACGCTGCCCGTTCATTTTCATGAAGTGCTGCGACTTAAGCG
ACAAGAATTCTTGGCTTCAACCGGTCAGTAGTAACGGACGTCAATTGCTCATTGAAGACGTCGCTCCAGGATGCTGGCCCTCAGCGCGTACGAAACACTG
AGTGTGCTCGGCAGTGGACAATTCGGCAATGTGGTGCTCGTTCGGCGCAATTCAGATCGGAAGCTCTTTGCGGCAAAAGTTCCCCACGGCGAGGACACCG
CAGCGAGGTTGGCTGCTCGTCAGGAGGCTCAGCTACTTATGCAGTTGCATCATGCGAACATTGTACAATTCATCGAAGTGGTTGAGGAGGATTCGCAGAT
AGCACTGGTGATGGAGTATACTAGCGGCGGAGACCTGGATACCTTCTTGCGATGGCAACAAGAAAGCACGTAAGCTCGCGAACTCATCTGCTTGAAGCAT
TTTCATTTTCACAACCGTTGATGTTGCTCGTAGGGGATTTCTGAGCGAGCCTGCAATCATGCGCATATTCATCCAGGTTGTCCTTGCGCTCCAACACTTG
CACGAACACCGCATTCTGCACCGGTACGCAAGCTTAAAAGAATACTGCTCAGATGCCAACGTGTAGAGCGACCCACTCACGGCTATAAGTGCCTTGTTGT
ACATGTAGAGACCTCAAACCGAAGGTACATGGCTTTAGCTCGGGAGCCGGTTATCGTGAACTACTTACCTACATGCGCGAACGGTTCTTGCTAGAACATC
CTACTGGATGGCGACGGGATCGTAAAGTTGAGCGATTTCGGCGTCTCGACGGTTTTGCAAAGCTCTGTGGACTCTGCTCAAACCATCACTGGAACCCCAC
ATTACATGTAAGCTACAATCGTTGTGCTTCTTGGTCTAGGGTATTGTTTTCATGATGCTCGATCTCAAGGTCACCCGAAATTCTCGACGGAGATTCTTAC
GACTGCAAAAGTGACGTCTGGAGCCTTGGCTGTGTGCTATATGAGCTGGCAACCTTTTCCCCACCGTTCACTGGCTCAGCCCTTGGCGCGGTTGTGGGTC
AGATTCTAAACTGCGACCCACCGCCAATCCCTTTGTGTTATACTCCACCATTTCGAGCTCTCGCAAGCAAACTACTCGAAAAAGACCCCCGTGTACGCGA
CAAATGTATCTGATGGATGCAGCAACACTTCTAAAGCAATGTGTGTGATATATGACAGCGGCGACCAGGTTTGCCAGAAATCCTGACTTGCCAAGCTGTT
CAGCACTCCATGATGCAGCTAGTGAGCGTTGCTACTTCGCATCAGCCCATGCTCCTGGAGCAGTTTGCTGCAAAAAAGAAAGACTGCAAAGCTTCACAGC
AAGATGAGATTACTCTTTCAGAGGTGGTAACTCCACTTCCCAGTCGTCAGGGCCTTGGTAGTGCACATCAAAACAGTGACCAAGCCAAAGGGTTCATACG
TAAAATTCAGCCGGAGACAAACGATGCTCGTCAGGTTTTCTTCGAGAACCAGGTACGATGCACTTCGAAGTACAATGCAATGAGCCATACGAATCTAACG
CGCATCACTCCTCCAGGCAGCTGCTCGAAAAAACAAAGAGCGCATCGTCCAAGAGAGATCATGTCCAGCAGTTTTCCTTGACTGCAACGATTGTAATTCG
CCAGATCACCACACTCAAGTCCAGGCGCAGATACAGAAGCCCAGCCTCATCAACAGCCCCAGTGGCCGACAGATACTAGAAAGTTTTGGGTGTTCTGTTG
CAGTAAGCAAGCCCGATATGCCGCCCGCACCTTCGTCTTTAGTTTCTGTCAGAGGTCGAGCTCAGTCGTCACCGTACGTTGTTACCATAGCTGGATCGCC
GAACATTGAAACTAACACTAATCCTTTCAGCTCAAACTACGAAGATCTACTAAATAATGAGCGACGACGCGTGCAGCTCGAGACCAAGGCGTTGCAAGAG
CGAATGCGAGTCATGCAGGCCACAGACTGAAAAAACTTCGACTTTTGCGGATCAAAGCTGTGGAGTAGCATTTAGAGTGGAAGCCTGGAAAGAGAAGGCC
AAAAAGAATGGATTATCTACTGTGGTGCTGGGCTTGAACGACTGTTGGAACCGATCACTACAGTTTTGCAAAACTTTTGCCGATCATTACTCAGAATGCA
TACATACATGTATCGTGGGCTTCGAGAATCTGCAACCTCTCTACTGATCTTCAATTGCTTGCTGCATTGGGCCCTTCATTTCGTTGCGATCCAACGCTAT
TAGTTGTGAATTCATTTGTTGGGGGTAATGTTTCTTTTCGAGTCCGAAATATACTACCCGGTAGTCATGAATAATGCTCGGTGTTGAGATTCTCATCCCC
ATCAAAGCACCATGAAGGCTAACCAGTTCGTCGAGTTCGGGTGCGTCCCAGCGCCGTCGATGCTTCAACTCACTCCATAATCCGTCCCCCCTACTAAATG
ATCCAATATCCCCACCTCCTACAGCAAAAAGATCGTGGCCATCGGAAAGAACTACGAGGCCCACGCGCGCGAAATGGGCGCGGCCTCGGCCCCCAAAGAC
CCCGTTCTCTTCCTCAAACCCACCACCAGGTACAGCAACAGTCGGCAATGAAATCTCGCGAAGGAATCGCTGAATTCTGTGACTTGTGTGGGTAGCTACG
TGCGCAATGGCGGCAGCGTGTTGCTCCCCCCTGGAATCGGCGAGGTGCATCACGAGGTGGAACTTGGCGTACGTCCCCTTCCTTGCTTTGTCAGGAGGAT
GGGTAAGAGGGTCGTGTAGTTAATAACCTGGTGGGTGCTTAGGTGGTGATCGGCAAGGGTGGCAAGGATATCACCGAAAGCGACAGTATGAACCACGTTG
CTGGCTACGTACGTACATCGACTTCACATGTAGATGAACCTTTGCTCTTTTTGTTTATTTTTTTTACTCCACTGATTTGCATGTGTTAGGCACTGGCGAT
CGACATGACGGCCCGTGATGTGCAGGCCAAGGCAAAGAAAGCGGGGCTGCCGTGGACACACGCCAAGGGGCTCGACACCTTCACGCCTATCAGCGACTTT
ATCCCTAAGTCAGCGGTACCTTCGCCTCACGACCTCAACCTCTGGCTGAAGGTGGACGACGAATTGCGCCAGAGCGGCAACACCAGCGACATGGTGCACA
ACATCCCATTCTTGATTTCCTACGTCAGTCGCATCATGGCGCTGGAGGAAGGCGATTTGCTCATTACCGGCACGCCGGAAGGAGTTGGACCTGTGCCAAC
TGACAGTGTACGTTTCTTCCTTTGCATTCTGATCCAGTAGCCACTCTCTTAGTTTGTTTATTGCTATCGTGTTGCATAAAGGTGATCACTGCGGGCATCA
CCGGTCTGATCGACGTGCGCTTCCCCGTGGAGACGCGGGTGTACAAGGCGTAGGTGTGCGTTTGTACTCCGAACAATAAATGGCACTTTGCTCAAGTAAA
GCTGCTCGATTAGCTGCAAGCTACAATTCGAGCCTTGGATGTGGTGGAGATGAGTACATTGCATGGTGTTAAATAGTTCTAACGCTGTTTAATGGGGGCT
GTCGCTGCTTCAACCAGCATAGACAACTTTCGGAAATTCTGTCTGCGTCTGGAACCAGCGAAAGTCGTCCGGACATGCCAGCCGCGGTAGATGGCCTGGA
TACGCAACGCCGCTGCATCATGTCGTAGGTTTCGTACTGCGGACTGAGCATAGGAACGCACTTCTGGCCGATTTGACGGTGCTCTAATCAGCCGCATCAG
CGCACCCAGCACACCGCTCTCCACGAGTCTCGAGCGAGCCACATGCAGCTCGGACACAGCCGCCAGCGCACGTGTAGCTTCCACAAGTAAGGCCTCACTC
ACGCCCCTATCGCTGCTGTGGCCAACTGTATGACTTCGATCAAGCGGACTTACGTATCGCACTAGCACAGGCAGGAGTCCAGCATCCACCAGCTTCAGTA
CATTTTCCGGGCGCTCGGCGAAGTTGGCAATTATCTGAGCTACGTGAAGTCGAGTGGAAACTAGCGGATGGAATGCAAATTGCCCCAGTGCTGACAGGAG
CGCGGGCTTACAGAGCGTAAGACGGGAGGGTGCGTCATGAGTGAGCTGAGCGAGTGCACCTAGAGCATCCACTTTCATGCCAAAGTCATCGCCAGCCAAG
ATGCCAAACAAGCACTTAACGACTCCGCGTGCCAGGAGCTCGATATAATGCTGATAGTCACGCTCGGAAGCTTGGCTTGCTTCCCATGAGTGTGCTTGTG
GACTCCCAGCCGGATTATCTTCAATACCCTCCGTATTCGCGGGATCTTGTCGCCGTTTGCGTTCGCTGCAAATTAACAATGTGAGTAACGTGATGACTGC
ACGGCGGACGCGTTTATCGGGTGAAGCGTATAATTCACGAGCTCCGATATGATCAAGCACCTTGGAACGAATAACGTGCTCTCGGTTTGCGGTGTTTTGA
GCTATAGCGCAGAAAATTACCAGTGTTGCTCGAATTACTGCGGTTGCCTCGGACGCTGGCCACATGGATGCAGACCGCAAGCGGGGGCGCGTTGATGAAG
CCGATCGAGGCCGGGAAGCAGACATCTTTGACTGGATTGGTGTCGCTGATGCAGTGCGCGGGCGTTTATCGCCTGCATCGGTTGACAGGCTGCTCGGGGA
AGAAAAGCAGAGCTGAACGAGCCTCGACATTGCTTCAGCTTGTACAAGTGCCTCGTGGTTAGCGTTATCTTTTGCGACAGCATCAAGAATGGCCACCACC
AGCAGACTCACTTGAAGCGAGGGCCTAGAAGCACAAGACGACCCGCGACCTAGTACGCTAAGCACGCAGGGCAGGAGCCCAAGCGAAGCGAAGCGACGAG
CATTTTCCGCTTCGGATAGTAGCAAGTGCACAAAACTCAAAAGTTCGCGGCGGAAGATCGCGTCCTTGTCCAGGAACGGATCTCGCAGCAGCCCCGACAG
TGTCGTGAAATGGCCTGAATAGTAGAAGAGCACTCGGTTATCACATGAAGCTGCAAGCTGGTGTAACACGGATGCCGCTAGCGTTCGCGTGCGTGTATCA
CTTGCCCCAACATTCCTTGCACTCTGCGGGACGCCACTGCCAGAGCAGCAATTCAGCATAAAAGCAAACCCTTCACGTTTGGCCACGGCTTCGCGCCACT
CGTCTGTTGTCACCAAGCGTGCGACGACTTCGAAACCAGCCAACCGCAACTTGTGGTCTGTAGTAGTGTGCAACAGAGAGAAGACGCAGTCAATGCCCCC
TGGTGCTTGAAGGAGTTTGGTCTTGATTGTCGATAACCGCACAAGCGCTGCCAGTGCTTGTGCACAGTCGTGAGATATCCCCGAGTCTTCACGATCCACC
GGCGAACTGAGCATGGTCAAAATCGCACCGAGCGTACCAACTTCGTCAAGTAGCTCAAGGTTCGCGGCTGCAACACAAGGGAGAGATTAAGGTCTGACAC
CAAACACCTCAATGGACATGAAAATGAGGAGAACGCACAATTACGACTGAGAGAGGCTATCGCGGCAGCTGCATCACGACGTACTTCGACGAAGGGAGAC
CAGTAAATGATCTCAATCAGTGGGCTCACGTCATCGGCCTCAACGTCTTGACGCCGAAGGCTTTTGAGGACATGGGCACTGTGAAGAGAATCCCGACGGC
GTTCGCCCTGCATGGCATTTAATTCAGCCTCGCGCGCTAGTAGCTGCTGTCGTTTTGGATCAGCTCGAAGAGATACCTTTTCAGGCGGGCCAACGGCATC
AGCTTTGGTAGTTGGAAGCTGGTGCCCATCGCTAGCTCGATGAAGCTGCGTCGGTTGTGAAATCCTGCGAATTGGCGGAGGGCTGGCCACGACATTCTGC
GGCTCTTTCGTTTTTGAATTCACTATTGAGGAATTGCCGTCTTGAAGCTTTGGCTGCGAGTCCTTCCTGCTGTCTCTGCGTCCTGCGCTGGTTGGCGATG
CTGTAGTGGCGATGGCGGCTCGGAACTGCTCTCGAGGATCCTGCGGCGCTCGAGCAGTTCCGACCTCAGGTAGGAGTTTGTCACTTGTTGCTACCGAGTG
GTCCGTCCTCTTGGACGATGCCGCACGTGGATTCGAAGGGAATAGATCAGTCGGAGGTGCATTCCATCGCCGCTTGGCGACTGGGGCCAATCCACTTCTA
GGCCGGGCAGACAGCGGCTTGGAGGTCAGAGCAGCCGGAGGCTTGGCACTCGTCGCCAGCGACATCTCACAATGGTGGAGACACAGGTGCAGCGTGAGAC
TCCGTCCGCCTATATTTACATGAGGCAAGAAGCTAAACATTGAACTAGTTACCTCCAGGCCACGGCGTGAACTTGGACGACAAACGGATCCCACTTTCAC
TGCTAGGCATTCTCGCGCACTTGGCATAGACGCACTTGGATGGCTTGGGGGCCGGTACAGCAGCAGTAGCCACCACAGTGCTCTCTCACTGGGAGTTAAT
CGATAGAATATCAACTACTTTGGGAGGAGGCTCCCGTACTCGGCGCCGACAAGACACCGCGTTGAAGTTGTCTCGGTGGTCGAAATTCTGAAACAAAGTC
TAAATTCTAAATCCTAACTGAAACGATGAATTTTGGCCAATCACCGGAAGTCACCCCAAAGGCGAAGACAAGCCAAGACCAATTTGCTGCCGCCATGAAG
AAGAAAGTGGGTGTCGTCCTCCTTGCCCCTGCCTCTGCAGGGGCCATCTACTAACCCACGAGTGCGTCTACTGTATCGCGATGCGCGCAGGTTCTGCTGA
TGGGCAAGTCCGGCTCGGGCAAGACGTCCATGCGCTCTATCATCTTCGCCAACTACCTGGGTACGGAATTGCGTTCGGTGGCTGTGTTGGAGCCCTCCCG
ACTAACTGAACGATGCGATTTATGTGCCAATTGACTAGCGCGCGACACCATGCGACTGGGACCCACGTGTAGGACGGAACTTTGACGATGCTTTAGCCCG
TCGAGATACATAGAGAATGACGTTTTCCTGCTTCTTGTAGTGGACGTGGAGCACTCGCACGTGCGATTCCTAGGCAACTTGGTGCTGAATCTCTGGGATT
GCGGCGGGTACAACGACAAGAACTGTTACTGCACTCGAGGCTGAAGCTTGTTCTAATGCTGTGTCGTGGTGTTTCTTGCAGCCAAGATGCATTCTACGAG
AACTACTTCGAGAGCCAGCGCGACCACATTTTCCGCAGCGTGGAGCTGTTGATCTACGTCTTCGACATTGAGAGTCGCGAATCGACGTACGTGGAGCTAT
CGAGGCTGTCTTAGTCTGGCTGCTGATGTTTTTTGTGTGCATTGCAGAAAGATATGGCGCACTTCGACGGCTGTCTTGAGGCTATCGACCAGAACTCAAG
CAACGCCAAGGTGTTCGTGCTCATCCACAAGATGGATCTTGTGCCGGAGGACCAGCGTGAGCGCGTACGTACGCATTGCCGAAGTTGGGGACAAAGCAAG
GTACGATGCTAACGATTTTTTTCGCGGTCATGTGCAGGTGTTCAACCAAAAGAAGGAAATGATTCTGGACCGCACGGGCCAATTGCCTACGGTGTGTTTC
GGCACGTCTATCTGGGATGAAACGCTGTACCGCGCGTGGTCATCCATTGTGTACTCGCTGATTCCGAACATGCAAGACCTGGAGAAGCACCTCAACAGCT
TCTGCTCCATTTGCAGCGCTGACGAGGTGGTGTTGTTTGAGCGTGCCACGTTCCTCGTGATCTCACACGCTACGCACACGAATCACCGCGACATTCATCG
CTTCGAGAAGATCAGCAACATTATCAAGCAGTTCAAGCTGAGCTGCAGTAAGACCCAGGCGCAGTTCCAGGGCATGGAGGTGCGTAACTCGAACTTCACG
GCTTACATTGACTTCTTCACTGCCAACACCTACATCATGGTCATCATGTCCGACGACTCGATCCGTAAGTTCCAGCATAACTGTGTTATTCTAGCGTTGA
AATGCATTTTCATACTAACAACTTGTTTGCCCTGGCGACATTTGATTTGAGTAGAGCCCGCGACGATTCACCTAAACATCAAGGCGGCTCGTCCTGTGTT
TGAAGAACATGTGCAGCAGACGAGCTAAGCTGCTATGATGGTCGATGTAATTGCCAAAGGATGCTTCTTGCAGTCTCCACCGATTCAGAGGCGCGCTCTT
CGGAGGACATAGTACCAACTGACTTGTATAGCTGGTGCTGAACCTAACTCTAATGCAGGAGCAGCTTTAACTTGACGATTTCCGAGCTTCTTTATTTCAT
ATACGCGCCAAGAGAGCTCCCAGGAACTCCACGCAGCGTTTGTTGGGAAATGCATTCCATGAAGTTTACTGAGGTGGCGGCGGCGGCGAACCTGACGAAT
TGGTTGCAGCAAGCATGTACCCTCTGCGTCTCAGCGCACGTAGAACCACGGGCGTGACGGCGAATGTAAGTGGCCACCGGACGGGGGCCAGCACCTTGTA
GATCGTGTAGGCGATGAGGAACGATCCGGCCGAGTTGGTTGTCGAGTCACTCACCGACGTGGACAAGCCCACTGCATCCAGAATGGACGTGACGTCCACG
CCGCTAGAGACTCCCACGTAGATGACGGAGAACGACAGCAGCGACAGCACAATGTGCGTGCAGATCCCCACGCGGCCGTAGACGACAGCGAACGTCTGGG
CACGTTGACGCCACGACTGCGGCTGGAGCTGCTCGTCTCCAGGCTGCTCCAGCTCCTTCTCCGCGTCTTCTTCGCCCTACACCAGCACAATAACACCATT
TACAGTGTCAAACCTGTTGCAGCAGCTTTTCAGATCCCCCAAAGGCAGCAAATCGCACCTTGACGGACGGCGACGATGTCGGTTCTCCACCAGTGAGCGG
CGCCGTCTCTTTCGGATCCTTGGACGTCCTGCCACTGGACCAGAGCCGCAGCATGCCACAGTTAGCACTGCGAGTCACAGGGAAGCCAAGCACATGGCGC
GACGCAGCGACGGCTGGAGGCCACGAGCAGGAAGGGGCGTGACCACTCTTGCCGCTGCTGGGGATGCTGGAGGACAGCGCTCGCGCCACGACAAGGCGCG
CCGCCCGCTGGAAGTCACATCACGCTGCGCCATGCCCCGATAAGCGCCCAAGTACCTCATTCCGCCGCGTAGCATCATCGAAAAGGACGCAGCGAGGCTT
GCAGCTTGATGACTTGGAATATCCACGATGTGGTGTACACCAAACACGACACTTTTCATCCTCCAACTGTCCCACACCGCGTCTTGGGCACTTGAAGCCA
TGTTTCGGGCTCCGACGCGCGGCTTCTGGGCGCTCCAGCGTCAATTGCGCGGCGTGTTGGCTGCCGATGCGTCCTCCCGAATGGGCGCCGGTCAGCGTGC
GCTACTCGCCACCACCAGCGAATCCAGAGACTCCGCGGAGTCGACCCACCAGCGACAGCAGTCGTCGTTCCTGCGCAGCGTCGACCTGAGTAGCCCCGCA
GCGCAGCGGAAGCTGTCCAAACTGATCCAGGAGGTGGTCAAAACCAAAGCCAATACCGGTGGTGCGTGCTGCAAAGCAGTTGCTAGAAGAGGATAGGAGC
TCACTTCTTGCTGCTACGGACAGATTTCGTGCCGCAAGTGATCGTCCAGAGCCTATGCACGACGTACCGAGGCATGGATATCGACGAGAAAAAGCAGTTT
CTGCTCATCTTGGCGCAGGACCTACACATTGACACGGCTCTGGTGCGATGGATGGATAGTAGGTAGTATTTCCACTTTGTGGGACTGACTGGGACTCTTT
TGTTTTGATTCTGTTGACGGTGAATAGGTTCTGCAAAGTGCTGCTCAGTTTGAGCAGAACTTGACTAATGTGCAAGACGCTCGCAGTGGTGTGGTGGGCT
GGGAGCACGAGAACGTGGAGCGGTACTTGCGCACGTTTCGCAATCTTCGCAATGCTTTGTCACCACTGTATGAAGTAAGAGGCATTTACGGGGGCTGAAA
ACTGGATGGGATGCTTTCGAGGTTTTGTACTAACGGTAGCGACGCTTTCGACGGGGTAGACCTTCTTCCAGCAAATCTTGTCGCAACGCGAAAACGGAAT
GTTGTTCTTGGTACACATGCGAGCAGACCTGCTGCAGGTTTTGCGCAAAAACGCTAGCCATTCCGAAATCCCAGCTCTCCGTTCTTTAGATGCAGGCTTA
AAAGTAAGTCTTCATGTGTGTGTTATGTGTGTATTCATCTGGATTCAACCAATTACTCAGTATTCACGCGCCTTCTACACAGCAATTCCTAGCAGCGTGG
TTCAGCGTGGGGTTCCTGAAGCTGGAACGCGTGACGTACGAGCACTCCCCAGGCCAACTTCTGGAAAAGATCATTCGCTATGAAGCAGTGCACCCAGTTG
GTACAATCGCCGAGCTCAAGCGGCGCCTTGGTACGTCCGTGCAATCCAGAGCAATTGCACTTGAATTGAAATGTGACCCGTTTTCGGTTCTGCCTTTGTA
TTGTACTATGCTAGGCAATGGACGGCGCTGCTTCGCGTTTTTCCATCCGAGGTAAGATCTCGCATACCATCAATATTAATATTTAAGTCTGATCATGGAT
GTGCATGTGTTGTAGTATTCCGGATGAGCCGCTCGTGTTTGTGCATGTAGCACTGATGCAAGAGATCGCCTCCAGCATGCAGTCAATTCGTGACCAAACC
GAGCAATTGGCAGAAGCCTCTCAAACGAAGGCTGCCATTTTTTACTCCATCTCCTCCACGCAAAAAGGACTTTCGGTAAGGGGTATCGCTTCTGGCATAC
ACATATCATTGAACTGATTTCGTTTATTCCAGGGTGTGGATTTAGGCAATTTTCTCATCAAAGAGGTTGCCAAAGCTCTCAAGGTGGAGTACCCGCTCCT
GAAAACGTTTGCGACACTCAGCCCTTGCCGCAATTTATGCCATGGCTTGAAACCCAGCGATACAAGACTGATGAGTCGCTTGTTTCTCCTCTCGAGCTGG
ATGCCCTGATCGATGTCCTGGACGAGCGTGGCGTTACGATCAACCCGATTCGACCGCTGTGGCTATTGTCCTGGATGCACTCTCTATTGATGATTGGAGC
AAGGATGAAAATCTCGTTGCACCGTTGAAGCCTATGATGCTGAAGCTTGGCGCCCGCTATATCTACCACGAAAAGAAACGAGGTAAGGCACTGGACCCCG
TTACTAACTTCCACGTTCGGAATGGTGCCATTTTCGAGCGGATCAACTGGTTGGCTGATCTATCCAAGAAGGTGCGTGGCTCAGGCGGTTGATCGTTGAT
GTGCTCACAAAAAACCTACTTATCGATTTGCGATTTTTGTCCATGACTGCTTCATAGGGCCTCGCGCAAAGTGCTGGCATGATGATCAACTACAAGTATG
ATCTAGCACACGTGGAGGTGAACAATGAGAACTACTTGCTGCACAACATCATCCCCATTGGCCTCCAACCGCAGCAAGTTCTTGGAGCGCGTACGCTTTA
ATTGCGTCGCAGGAGAACTTTGTGTAGTACTTGCCAGTAGTAGAGCAGAAAGTTTGCTTGAATTCACAGTCTCGACACGTAAGGAACGTTTCTGTTTTTT
TGTTTTAAAGAAATCGACCAGAGCAGTCTTTTCTGGTATCCCTGTGAAGAGTCGTAGCGCAACGAAGCCGTGATGGTGTTGGCACAGGATGAGATCGATG
CTTGTCGGGAGGCATTCCTGGCTTTCGACAAGGATCGGTGAGGGCATTACAGATGGCCGTGCGATGATTGAACCTGACAGTGTGCTATTTTACGCTTGGC
AGGAGCGGAACAATCGATGTCTGGGAGCTGCGTCAAGTGCTAGAAGGTAAGTGCTGCGCCGGCTCTGGTTATTCAGGATTTGTTCCAACTAGCGCGTCTT
GGATCAGCAATGGGGCAGCAGCCAACAGAGGAGGAACTATTCCAGATGATCAGTGAGGTTGATGAAGATATGAGCGGCGCAATAGGTAACCTTTTAGACG
CGACTGCAGCGGATATTGTACATTTAATCCTCATGCCACACCGGTACCAGACTTCGCTGAGTTTCTGCAGGTGATCGACAATCAAAAGGATCGCGCCGCT
ATGTTTGAGGATGACAGCGACATGAGTACGGGAATTTCGATTGAGGAGATTGCGGGAGGCGCTCTAAGTGTCATGTGTGCTTTCGTAGTTGATGCGTTTG
TTGCGTGCGGTGGCAAATCCGACAAAACGGGGTTTGTGCGCAAGGAGACGCTCGTGAAAATTATCAAGAGTGACTTTGGTCTCACTATCAACATTGAGGA
GATGATCAACAAGCTAGACGTGGATGGCAGTGGAGAGATCGAATTCGACGAGTTCAAAGCCATATTAACCTA