Description :
From Genome Similarity Track
Location :
Scaffold_396:22008- 24157
Transcript NameFunction/comments
Phypl_g7824myosin-like protein

Sequence
2149 bases(100 bases per row)
AAGCAAATGGCCGTCACGAAGAAGGGAGCGCTGGTTGTGAACAACCGCGGTCAGTACTGTGGTATTTTCACCCCTAAGGAAATGCTGGAGAAAGTGCTTG
CACGCGGTCTGCCTGTCCACACAACGCCGGTGTGCGAAgtgatggtggagaaggatGTGACTATCAACGGAGCAACTTCGGTGATTGACGCCATGCACAC
GATGCACGATTACAAGACGCTGTACCTGGCTGTGATGCAGAGCGAGACTAGTAAACAACCCATCGGCCTGATCGATGTGCTTTCTTTGAGCTTCGGTTCT
TTCGCGAAGGGCAAGCCTAGTGAGTGGAAGTCCTTCTGGAACGCTTCATTCGAGGCTActgatgacgatgaagtaTCGTCGCAGCACAGTTTCCGCAGTG
GATTCTCGCACAACCtcgcgccaagcagcagtggccTGAGCCAAAAAGGCCGACAAGCGAATTTGGCGACGGGTACTGTACGCccggtgtcgaagctgcg
gccaTCGAAGGCTATCACAATTTCGGAGACATTTTCAGTTGCCGACGCTGCCAAGGAGATGAGTATCACGCAGACGGACGCCGCACTGATTATTGGACGT
GACGGTGGACTTCTCGGTATTCTTACCGACACTGATGTGACGCGGCGTGTGGTGGCACTGGGCAACGACCCGTTCTacgtgagcgtgctggaTGCCATGA
CCCCGGACCCGAAGTTTGTGGACGAACGTGACAGCGCCATGGATGCTATGTTTATGATGCTTGAGGGCAAGTTCCGTCACCTGCCCGTCGTAGATGAAAC
AGGCATGGTTGCGGGTATGCTTCGTATTCAGAAGTGTCTGTACGATGCGATCACTCGCATTGAAAAGGTGCAACAGTCGTCTAGTGGATCGCTCCGCCAA
CGCCTGGAGAAGCAGTTGCACGCCACTGGTATCGGCACTGGCCATGGtgcgctgaagcagctcgtggcccCCATGGTGGAGAAACTGCTTTCGCCTACGG
TGGACTCGATcctggaggacgagacgctTCCGCCGCTTGTGAGTGAGCACGATACGGTGATGGAAGTGGCCCGCCAGATGGCTGCGTCCCGCAAGGCTGC
TCTCATTGTGGAGGACCCGAACGGTGACAACAGCTCATCTGTCAGTGGTGGACACCGCTCTTCTATTAGTGGTGGAGGCTACGACATCGGTACCTCTGCG
CTTACTAGAAAGGTTCTGGGCGTGTTCACGCCGAAGGATCTGCTGTTGCGCGTGACTGGTGCTGGTCTAGACGCTGCCGAGACTACCGTGGGCCAGGTCA
TGACGCCTAATCCCgagacggcgccgcccaACACGAGGCTTGTAGACGCGCTTCACATCATGTACGAGCATAATTTCCTGCACTTGCCGATTGTCAATGA
CGAGACGACTACAATTGTGGGCATGCTTGATGTTCTATCCCTGTGCTACGGCACCTTCGCGAGTGGCGCGGCGGCTGAAAGTGGCAAGCCCGTtgacgag
gactcggactGGCGTGCATTCTGGGATGTGTCACTGGCGCTCGGcaacgatgaagacgactTCAGTGAGCTTGCTAGTCTGACGGGCTCGCGAGTTTCTC
GCCGGCGTCCAGGCAAGTACACGGAAAGCCACCACTCATCGATGATGGACCACATTCCCGAGCCGGAGGGCGCGATGCGTCCTGTTTCGATGCTGCGACC
ACAGGAGGTGACCCGCATCAACGAGTTCATCACTGTGGCCGAGGCGGCGAAGCGCATGCGGCAGGCACGCGTCGAGGCTGTTGTGGTGACTACAGAGGAG
GGCGAACTTCGCGGTATCCTGACTGACACGGACATCACGCGTCGCGTGTTGGCTGAAGACATCGATCCAGAAAGCTGCTCTGTTGCGTCTGTGATGACCA
CGAAGCCTATGTGCGTGTACATGGAGGACCAAGCTATCGAGGCAATTACAAAGATGCTCGAGGGCCGCTTCAAGCACTTGCCGGTGCTCGGCTCTGACGG
CACTCCACAGGGCATGCTGGACATCTCCAAGTGCCTCTACGATGCCATTACCTGTCTTGAGAAGGTTCAGCAGtcgacggaggcggcggcgtctgaATTC
TCGCGCGACTTGGGTACCGGTTCAAACCTTCAAAGGTTGTTGGGCCCCa