Description :
From Genome Similarity Track
Location :
contig_47:220071- 265543
Transcript NameFunction/comments
g9670.t1hypothetical protein
g9671.t1RAW27616.1 hypothetical protein PC110_g15977 [Phytophthora cactorum
g9672.t1RAW27619.1 hypothetical protein PC110_g15976 [Phytophthora cactorum
g9673.t1POM57719.1 Rab11 family GTPase [Phytophthora palmivora var. palmivora
g9674.t1XP_009523306.1 hypothetical protein PHYSODRAFT_313196 [Phytophthora sojae
g9675.t1XP_009523333.1 hypothetical protein PHYSODRAFT_354318 [Phytophthora sojae
g9676.t1RAW28617.1 hypothetical protein PC110_g15014 [Phytophthora cactorum
g9677.t1XP_009523331.1 hypothetical protein PHYSODRAFT_497615 [Phytophthora sojae
g9678.t1RAW28619.1 Vacuolar protein sorting-associated protein 4 [Phytophthora cactorum
g9679.t1hypothetical protein
g9680.t1RAW28614.1 GMP synthase [glutamine-hydrolyzing
g9681.t1OWZ13564.1 Ras-related GTP-binding protein [Phytophthora megakarya
g9682.t1hypothetical protein
g9683.t1KUF77196.1 Malonyl-CoA decarboxylase [Phytophthora nicotianae

Sequence
45472 bases(100 bases per row)
GTTGTTTCAGCAACACAATCTCCTTGTCCGCCTCCAGTTTCAACGCCACATACAAGTCGCGGAGTTTCTGGAAATGGCAGCACCATTAGTTCCTGTAACG
ACGATCTCTTACAGGTGGAAGTGTGTCGGTGCGATTGCTTACCTAGAGCTCTCGCCTGTTATGTACTTCTCGAAGGCACCGACTCGGAGCCATCCACTCT
TCTCGGGGCCTCCAAGAAGAGTTTTCTTGGCCAATAAGGTGGTTTTTGTCTCCGACTCGGCAACTCATTTCAACCGTTCTTGTTGAGGTTCCTACTCGAG
ATGGTTGTGTCCACGCTGAACGATGGATATGAAAGTGGCACCATGGAGTCAGCATTTTGTCTGCAAAACCTTAGACCTGGAATGACACGATCTTCACGAA
AGGTCGTCTGTCGCCGTTGAAAACACGCCAAGACACCTTCGTCCTCCCCGATGCGCTGGTCTCCACTTGTGCTGCTTGGCCTTCTCTTTGCCATCTTGCA
ATGTCTAGCGTGTTGCCACGCGAAAACGATCGATTATGAAGCGCTGGAAAAATCGTGGGAGGTTGGGGACAATGATGCAGAGCTGCGCACGGAAGGAGCC
GAGCACTATCGGCAGCTTGCAGACAAGTGAGTGTACCATAGCCCACCTTGATACAGCATGCAGCTCCAGCAAAACTCATTTGTTTGCCCTTTTTATCAGG
AGCGAGGAACAAGCGAAGGCTCTCGGTCCTCAAATGATATTCGTAACGATGAAACACGGCGGCGATCAACGACGAGAGCCTCTTCCTGGCGTTGCAGCAC
GATGGAAAGAGGTAAGATTATAAAGCGGTGGCTGCATGCACTAGCGAACTTGTAAGTACTTACATGGTTGGTTTTTGCAGATGCTGTGGAATGGTGGGAT
CGAAGTGAACATCTACGAAGTTGCCGAATCGAAGCTTCTCGTTGGACTACAGAAAGGCATGTTCGTCAACGATGTCATGCGCTTTCTCGACCAGCAGCGA
GACGTGAGAGAGTACGAATGGAACGGCAAAACGTATTCACACAGCACCAAGTCGACCAAGCTTAGCCACCAAAACCACCGTCAGAAGAAAACGAAAAAGG
CTCACCGAAAAAAAGCACACCACCCACAGTCTAAACGCTCAAAACTAGGCCATCACGTGCACATGAACGGAAAACAGCCTCGCCCTAAAACTCCTCAGCC
CGCATTCTCTGAAGACACTGCACAACCCAAGATGACAGAACCTCCCCAGCGTAGCGGGCCAAACGATGAGCTGTGACATTAAGGTCAAATGTTTATCTGA
ACACAAATCCACTCATTTCCACCATGCTCAGCTCTTTGTCTCTTGTGTCGGTTCGGCTTAGTTGCTCGTGCGCTCACTCCGAATAGTTTCAAGCAACGGG
CCCAGCATCTTGTTCTTCTTTGCGTTCTCCATCACGGTGTGCAGTCTCGGGTGGGAATCTGCGTCACGCACAGCGCTGATCGCTTCCAGAGCACGTAACG
CGCTACGAATGAGATCCTTCACGCGCTCAACCTCAGGCCCAACCTGGTCCTCTTTGACCTTCTTGTTGATCGTCTTCTCCAGCGGCTCGACCAAAGAGTC
CAACGCACCACAATACTACCAGGCTGAACGTAGCAAATCTTGATCAAGATTTGGTGACTAAGCATCTGAACGTCGTCCTGGTCTCCCAGACCGCGCTTCA
GCTGGTCGAAGAACAGCGAAATATCCAGCTGCTGCGGTAGCACCTGGATCAGTGTATCCACACACGAGTACGCAGCCTTACGGAGCGGAAGCCCATCATC
CACCTTGTGTTTGAACGGACCGAGGTCAACCACTCGCTCCAACTTAGTTTCTGTCGCCTTCAGGAGCACTGGAAGATGCGCTCACGGACGTACGGCACCA
GATAGTGCGCGTGGTGGTGAGCCGCCGTGTTTAGCACCAGCAGGGCAGCCCGGCGCACGTGCAAATCTTCGTCTTCAAGCGCCGCCAAGAAAGGGTCGAT
GTGAGCGAAGATCGCGTTGACCGCAGGCTCTTGCGCCGTTGTCGTCATCGCATACTTCAGACTTGTCACGGCGGTCCAACGAGACCATACGTCAGATGAT
CCGCAAAGTTCCGTCACAATGGGCATGATTTTTGTACTGTCCGTCACGGCGAGTTTCCCCATGCATTCGCCAACCATATTGCGCACCCCCTCTTCTTGAC
GAGCACTCATCTTCTGTAAAACTGGCAGCACGCGGTCTACATACAGCGCAAAACCGTGGTGAGGCTTAGCTGCGTGGTCCGAAATGACTTCGCGTAGCGA
CGTCAGCAGCAAGTAAGAGTTCTCTCCAATCTCCAACTTAACCATGATAGTGTCCAGGTACTCTTCCATGTTGCCAACGCAGATACTACCGAGAGAGTAC
GCTGCCGCAGCCTTCACTTCCTCGCCCGCATTACTGAAGCACTTTAGAATCGTCTCCTTCACGTCGGTATACCCAGCAAGCTTGATCTTGCGGCCGAACT
CGCCCAAGCAGTATAGCGCAAGCACTTTGTTCTTTTCGGACTCCGTTTGCGTGATGTCACCTACAAACTTAGCGAATGCCACCTTGCGATTCGTTTCAGT
TGTAGCCACACATGTACCAGCAACACACCGAGCGATGTTAAGCACAGAATGTTTCGATTCTTCCAAAGGTGTCGCCATCAGCGCCTTGAAAAGTTCGGTG
AAGCTGCTGCCCGGAGAGTTCAACTGTGTGAGTTGCGCGAAGAATCCCTTCAGTGCATCCAAAGTAGGCCCCTGGAGCATGGAGCTATGACAGAGCTCCA
GTGCCTTCACTTGAGCATTTTGCAGCAAAGCGTCTGTCGCAGCAACGTGCGGACACACGCGGAGAGAGTTTGACACCAGCGTAATGCTCATGCGGCACAA
TTGAAGGTCCACGTCGACAAGAAGGAGCGAAGCTTCTTGGACAACTTCGTAGTGCAGAGACTCCGGCATGCTAGCTCCCTTGCGCACAACCAGATCATTT
AGGGTAGCCAGTGTCGCTTGCTTCAACGTGCGAGACTGCTGGCGAAGCAGCTGGGCCAGAGTTTGTGTGCACTCCACCAGAATAGGGGACATATCCAAAT
CGAGCTTGGAGCGAGCAATGACTCCGATGGCCTTGATAGTCTGCACTCGCGTGATTTCGTTGTTGAGACGCTCCATGAGAAGCGGATAAATTTCGCCCAC
CCGGGGACCAAGTTCGTCACCTACAATCATACCAGCAAAATGTTAGCAGGGAACACTCGCTTCGTGAATAAAGTTGTCGACAACGTACCGAGGACAGCAA
CGATCTCCCCAATACTGCTGATGGCAGCCTCCTTAATCTCTTGATCGATATCATGAACCTTCAAGCTAGGCAACACCGCTTCGAAAAAAGGCACAGCGTA
CGGCTTGTACGCCATGTCTCCATCGTCAACCCGAATAATGCGGACTAGAGACTCAATCAACCCCAGCGCCTTTGCCACCGTTTTGTACCAGTCTCCCCTC
GCGCATTGCACTGCAACGTTGATGACCGAATCAATATGCGGTCGGAATGGTTCCACCGTGTGCGTATCCACGAGCAGTCGGAGAAACAGAAGTGCATCCA
GCTTTAAGTCCGAGTGCTTGTCCTCCACTGCGTTTAAAATATTCGGCATCAAACGTCCAATGTAGTCTCCCAACTTTCCGTGCTCCACCATGGCGAGTTC
GCTAAGCATCGCAACTACAGCACATCGCGACGGAACTGAAGACTTCGTTCCAAACTGCTTGTTGGCTCCAGCCACGATCGTGTTAAGGCGCTGCTCCAAC
TGCGTAACGCATCCGTTCGACTTAGGTGGGTGAAAGGAACCAGCTCCATTTGAGCTTGGAAGTGTCTTGTGAGTCGCACGAAGAAGCTCTGCAAATACGC
CAAACACGTCGATCCGAACGTTTTCTTCTCGCTCTTTGAAGCGCGAAATAAGGGGCTGGGCACAGTGGATGTAGAGATGTTCCAAAAGCTCTGATCTCGT
TGTGATGATAGCAGTCAAAACACGAAGACTGGCACGACGGACCTTCCAGCTGGTGTCGTCATCGTCACTGTAGTCGCCTTCCTCATCACTGTATTCCTCC
TCTTCCTCTTCCATGTCTTCATCTTCGTCGGCCGAGTCGACATAGTTGTAGTTGGGGTCGTACGAAATAAATTGCAGCACAAGCTTCAGAATAGCTTCAA
CGTGAGGCGTGATCTCGTTATGGCATCGAACGATAAATGCTTCAAACGCCTGGAAGCAGTTGCCTCGAAGCTCATCTGAGTCTTCGTTTTGCAATGACTC
GTCCTCAGGGTCTCCGCAGAACTGAACCAAGATTGGATCACGGCGTCCAAGTGCCGCCCAAGACGGTGGCCTGCAGTGCGCGAGAGCATTCCGATCGTCT
GGATCAACGTGCGCACATTCGCCGAGTCGGTTGAGCCCTGAATGCCCTTGATCAGGTGCTCTACCAGACGGCTCACCAGCACGTCAGACGCCATGACACC
CAGCGACCCCACACAAGCCGTGGCCCGCTTGCGCACCAGCGGCGATTCGTCAGTCAGCTGCACCATCAGCAGCTCCATAATCGTCGCGTGCTCCGTTGCG
ACGTCGTAGCCAAATCGACGCAGCAGGTCCGTGAGGATGTCAAGCGTCTCGGTCTTGACAGCCGCGTCCTTGTCCTTGCCCAGCCCCGTGAACAGACGCG
TGCAGATGCTCGTGGCAACAGACGCTCCCGTCGTCTGGGACACGTCCGCGACGATGGTCTTGAGTCCAATCGAGTAGATATCCCGTAGCTCCGGCTTGCC
GTTGAGAATGAGGTCGCAGAGCTTGGCGCAAATGTCGGCCACCTGCGCTACCTGCACTTTGGTCACCAGGACGCCCAAGCACTTGACGGCGATGGACTGC
ACGTCGTTCGACTTGTCGTCCAGTTGCTTCAGCACCGCTGCACACACTCTGTAGTGCCACCATGCACACATTTAGCCCCTTTCCTCAACTAGAAGAACTA
CAAGCGCCTTACTTTGGCTCGAGATACGGCCCCAGCTCCACGTCCTTGTTGAGCTCGCTGCACAGATCAGAAGTGGCCATGTAGCGCTCATCCTTGTCAA
AGTCCGTGGTCTGCAGCACACACACATACATCAGCACCAGACCCCACTGGCTACACGGAGTGAGACGCAGCGCACCTTGTCCAGCAGCTGCGCGATCTTG
TCCTCGTTCGCGCGCATGTTTCTCCTCCTCCAAACGTGAAAGCGAGTGATTTGAAGGATCTCGGGATGATCATGTGCACCACATCAACGACCATCACTCT
GGAACCGTTACTTCAACGTTGGCTCGCATTCGCGTTTAAGCAAGCGACGCCCATGAGTGCGACGCGCTGCTAGTTGCTTGCCGTATATACGTCGATAAGC
TAACATGTCTGCTGTGAGTGTGCGCAGGCGAGAGCGACAGCACCGTGGTGCCTGACCAGCTTGCGTCCCTCATTTCGGATGAAGTGGAGCGCCAGCTGAG
AGAGCGCGGCTCCGTGCTCGAGGCCATGAAGGAGCAGATGGCCAAGGTGCTGGCCGAGTTCGAGGAGATGGCGGTCAATGTTAGCTCCAAGCGCTCGTGG
TCCAACAGCGTCGCGAGGACGAAGCCCTTCGCCTCGCCCAAGAAGGCGCTCTTCGACATCCACCCGGTCGTCACGCCCCTGGATATCGTCCCTTCTTCAC
CTCCAAAGCTGCCCAAGTAGGAGCAGTGCAAACTGCAGAGTGGAATGGATGTGCGTCTCACCTGGGTGTGTATACTTTTGCGCAGGATTAGCGGCGGCCT
GCTCAAAAACATTCATCAGCTTAAGCACAACGCTAGTGGTGGTGCCCTACCGCCAGGCGGAGCTCGTAGTCCCGACGGCAAGATCACGTTCGGTAAGCGC
TCATACTACAGTGTAAGGAGCGTGTCCTGGATGGTATATTTTAACTACGTTGTTGACCTCTAGACAAAATACTTCCTCGAGTTGCTCACATTGAAAAACG
CACTGACGGTGCACAGATGATGTTATCGCAGCAGAGACAGCAGATGTACGAACGAGCTCTGGTACGATATCCGCAATGCCGAAGCAACGTTTTTGCTCCC
AGCATGTATGATCACGAAGAAGTGTCCAACTTGGATGCAGGCTCAGCACCTCAGGCACCCCGAGCGTCACTAGAGCTTGATTTCGTATATGGATGCCGAA
GTGGAGCCACGACGTCGCTTTCCAGCAGCCATCCTGCAGCAGCACCTAACACTAGTACCAACAACAGCGCTTTCTACCTGTCAACTGGTGAAATTATGTG
GTTCGCAGCGACGTTAGTGATTCTTTACAGGAAAGAAGCCAATACCCAGAGGTATTTCCGGGAGCACACGAACGAGGTGACGAGTATAGCAGTTCACCAG
AACCAGCGCATTGTAGCATCCGGCCAAGCAGGACGATCGGCGTTTCTCTTGGTATGGAATGCGAACGATGAACCGCTGGGCAAACGGTTTGCGTGCCTCA
AGGGCCACCAAGTGGCAGTGCGCTCCATCAGTTTTTCTCATGACGGTAAATTGATCGCTTCGTTGGGTGGAGATATGTACAACACCATTTGCATCCACGA
CTGGAAGGCGCAAGAGTTATTGGTAAGTGCTCGGGGGCACACGTTTCGGGTTCATGCGGTTGCATTTAATCCTTTTCAGGCATACGGTCGGCCAGAAACT
CAGCGATCAAAGAAACCTGGCCAAGCTTTGCACGATGACGATGCATGCTACACCCTAGCAAGCTGCGGCGTCCGGCATATTCGCTTTTGGACACTGACAA
AGTGCGTGCCCCCTCCATCAAAGGAAAATGTCGACAGTGCATTTTCACGCTCTACATTTGGTGGTCCTCCAAGATTGCGTCCTCCAACACCGACTGAGAA
GGTCTGGAAGCTGGAAGGCAATGTTCCATCGTTCCATGGTCGATTTGAGGTTCAGGACTTTACAAGTTTAACGTTTGTGAACGATTCACCACCTCTGTAT
ATGTATGATGAACACTCCAAGGAGTTGACGGCCACAAACGCTACTGATCATTCGCTGGGTCGGATCGTAGCTGGCACGGCTAACGGAGATCTGTGTCTGT
TCTTGCAGCCAAGGGCAAGCCCCAATATTGATTTCGTTTCCGAGGGTGATCTTCACAAAGAGCCTGCAAAATGGTGGGAAGTTCCAGACGAATACACTGA
TGCTGAGATCAACGAACTCGTATTAGAGAAAATCGCATACGAACCAACAGCGAGACTCATTGATATCGTGCCTCATGACCAAGAAACTGGTAATCGATTT
AAACTACCTAAACAAGCTCAAGCGGAGATGCAGAGTTTATCCAAGAAAATGGCGTTGAGGCCCAACTCAACGGCCTTGTTCTCACGGCTGGGTGAACTAA
AGTATAGCGGTCCGTTAGCTCACCAAGGAGCAGCTTACCAGGTGGCGTACTCCAAGAAACGCAATACGATTATTTCATGCGGAAATGAAGGCAAATTGCT
GCTGTGGAAGTGTGAAATGAGTAAGCCGCTACGAATCCCTGGAGTTAATACGTTAGGAGTCTTCACACCACTGACTGGAACATTTACAGAGGGGTCTCAC
GCGCTACTTCCACTCGATGAAAAGGTATTCTACTTCCCAACTATACTACCACATGAAGCGAGTGCGGGTAGCGCTGCTGCTGCACCCAAGCCCACAAGTA
TTGTATGGAAAGATGACGGGAACTTCGTGCTTGTTGCCACAAGCAATAGCTGCGTTTGGGAACTAAATGTCGAGTCCGGGGATTGGCAACTACTGTTTGA
AGCTCGCAGTGGAGCTGTGACAGCTTGTGCTGCACATCCAACTATGCAGGAAGTGGGGACTGTATCCCAAGACGGATATCTTAGCATCTGGGACCTCCGA
CAGCACGTGTGCATTCGCCGCCTGTATCTTGGGAGCTTCATCACCGCTAGTGTCAAAGCCTTTTGTATGGAATTCCATCCAGCTGGAAGCGAAATCGCAA
TCGGGCTCAGCTCAGGCGAGCTACTTGTTGTCGACTATGATTCATTCAAGGTGTTGCTCCGGAAGAATATCAAGTCGAACTCCGGCAGCACTGCCAATTT
ACGTCTCTCCGGTCCCGCGTTTCGAGCAATTGCTCAGGTGAAATACTGTCCAAATGCAAAGTTCTTGGCAGTGGGTGTAAAGGACACTTTCGTTTACATT
TATGATATTGTGAACGGGTACAAGAAACTTCACATTTGCGAGGGCCACTCAAGCGCTGTGATGCAATTAACTTGGAACAAGGATGGCGATATCCTGCAAA
GCAATGCCACCGATGGTGAGATTCTCCACTGGATAGTATCTCCTGTTAAGGGTGAAACCAAACAGATTACTGATGCGTTTCTCGTCCGCGACGTTCAATG
GATTAAATGGACCTGCGTGTTCGGGTGGCCTACGCCTGGCATTTGGTCCGAGGAGTCACCCAACCTTGTAGACATTGCAGCAGTCTCCACTACAGGCCCA
AGGACTGCTAATGAGTACGATGAATGTGGAAACGCTCACACCACCTCCAACGAGGACTTGCTGGCAGTAGCGTGTCGATCCAGTATTCATCTTTTGAAGT
ACCCCGCTCATCGTGGTGCCAAACGAAAGGTGTACAAGGCTCATTCGTCCGCTATTTCAGCATTGGGATTTTCATTTGATGATGCATATTTGGTTACTGT
TGGTGGAGATGATGGAACTCTCATGCAGTGGAGCGTTGTGTTCGATACAACAAGCTCCAGCCCTGCTGGTGTTAAAGTACCAGGTAGCACTGAAAAAGAT
AAATCCCGGACACCATTTGCAGAAGATGATAGCACTGGAGAGCAGTGGTCAAGTTCGAGTCCTGCCCCTCCCCCGCAGGATGGCAAGCAACGATCAAATC
AATTGTCTCCTCGAAAAAATTCTCGGCAGTACCGCGAACGCCTAGTTTATCAGGACGATAGTAGCCGAGAACCTGAACCAGTCGGTGAAAGCGTGCATCG
ACATCCGAGTGAAGAAGAGCCGATAAGCGATATCCGCAGCGACAATTCTAACGAGGACAGGAGTTCTCAAGCAGGTGCCAGTGGTCCACCGGTAGAGCGA
GGTGTCAGCTATCGAGGTAGTACCGATCTCGACGAGCCCCGTCCTGCACCTGTCCAAGTTCGAGCAACACACGACTACGCAGCTGAAAGCCCTGACGAGC
TTAATCTCAACCGTGGCGAGATTCTGCGCGTGCTCTCAAAAGCTGGTAGCGATTGGTGGCTGGGCGAGACTTGTGATGGTACCAAGGGCTATTTCCCCGC
TAGTTTTGTAGAAGACGTGGACCTTAGCGCTCCCGTCTCCGGCGACGAATCCGTACCAAACGAGGATCCGCCAGCAGAAGGGTAACTGTGGTTATTAAGT
TTACATTTGCTTCTGTTGCTTTGAAGTTGTGTCATTTGCTGCTGTTGAAGTTGTCTGCGACGTGTGACGCAAGATGGCTACAGTTTCGGTGGCTCTAGTT
GGCCATTTGCTCTCATGGCGACACCGCCGTCGGACACGGCGCTGGGTGCCACCTCGACGACGTTCAGAGACCTGCCGCTGCACGAAGATGTTGCTCATGC
GCTGACGGCCATGCGCTTCCTGCGCCCGTCGCCGATCCAGCTGCATGCACTGCCCGTGGCTCTGTTCGGCAACGATGTCATCGGCCAGGCCAAGTCGGGC
ACTGGCAAGACTGCGGTCTTCGGAGTCACCGCCATAGAGCATTCGATTCGTTATGTGGAGCAGCGCGGTCAGCAGACAGAAGAGCTGATGGTGGGACATC
CATTAGCGCTCGTTCTAGCGCCCACGCGAGAGATTGCAGTCCAGATCGAGAGTGTACTCCGTCAATTGGCGCAGTTCCGACCGAGCTCGTCATTCGTACG
TGCATCGGCGGTCTACCAGTGGCGCAGGACCAGGTAGCGGAAGCAATACATACGCATTCAACCGGTAGAAGATTGAATGGAGCTGGTATTTGATGTTTGC
AGATGCACCTGGCGGCGGGCTGTCACATTGTTGTGGGCACGCCTGGGCGCGTGAAGGCGCTTGTGGATCAGTGCTCACTGCCGTGTAGTGCAATTCGACT
GCTGGTACTGGACGAGGTGGATAAACTCATGGCGCGAGACTTTGAGAAAGATGTACGACTGAATGGATGACATTGGTTACTTAGCTAGGGACTGATTGCC
GTCATTTCGATGCGTGTACAGATCCAGTATATCGCGGACGCTCTCCCTGAAAGACGACAAGTAACACACTGTCTCTGTGACGAAAGCTACATGTGATAGT
TACGTTGCTACTTTGATTTTGTGGATTGCAGACCCTCGCATTTTCTGCCACGTTCACACCCGACCAGTTGATAGCTGTGACCCAACTAATGAGGACACCA
CAGGTATGTTGGAAGGAACTATATCATGAATTACCCAGTTCTCTATATACCTGATGATACTTTCTCGCTTAGATTGTGCGCGTTCGAGGCCCGGGTGATG
TAACAACCGAGTTCATTTCTTCCGCTGAAGATCTTTCAAACTGGAAGGACCGAGAGCAGTCAAACGCGCCTGAACTCTGGCTTCACCATGTGCGACAGTT
CTATAGCGTCGTCAAGTCCGCGCCTGCATCAGCCATGGGAGATGATGTATTGAATATGAAGGCGAAGGTAGTCAAGTTGGCAGCGCTGCTGTCAGAAATC
GTATTTGTGCAGTGTATGGTGTTCTGCAACGACAAATTTCGCGCGGAGGCACTAGCCACAGCTCTTACAGCGCTAGGCTGGCCAGCAGCATGTATCACTG
GAGCTCAAGCTCAAGCTACCCGCCTGGAGGTGATGGAAGACTTTCGCGCATCCCGCTCGCGTGTGTTGGTAACAACCGACCTCACCGCGCGAGGTATTGA
CGTCGACAATGTCAACTTTGTGGTACGTTGTGTGGAAAGCGATATATAGGCGTGTTCAATTCCTTATCTATGAACTGGTAGGTGAATCTGGATCTGCCAC
GTGACCCAGCGACGTACTTGCATCGCGTTGGAAGGACTGGTCGCTTTGGCGGGAAAATATCCTTTTCATCATGTCTCCTGCATTGATACGGTTGAGTTTG
CCGGACCTCACTGATTCCTTAACCAAGAATTCTCTTTTGTGGTTGTTGTGCGTGCTTACGGTTTAGCAGTGACGCTGCTCTCTAGCAATGAAGTGCAAGG
AGTCCATCTGCTTGCTCGAGTATTCAAGATGAAGATCAGCGAATTGCCAAGTCCAATACCCCGGGAGATCTACTCATACGCAACTGAAGAGGAAAATGAT
GACTGCAGTGGCGAAGGAAATGAAGACCCTTCAAAATCTGCGGTGACAGGAAAATTGCAGAAGGAAGATCGTACCGCATCCCATGAACATGAAAATGACG
AGGAGAATGCCCCCGACTGCAGAACAGGTCGTCGAGGATAAACCGTTGTCGAGAGAGACCTCAAGTCGTTATGAGAGGGAGGAAGGCTCGTATGAGAGCT
GGGTGAAGTTGCTGTAGCCGAGCACGGCGCTTACTTTCTGGATCTACGAAATAAATGGCACAATTTTGACATACAAGTAGTTGATTGATGTCAAATATGG
GGATCTCGTGCACCGAAAAACTAGCCGAACTTCTTTACGATGCGACGCAAGGTGTTGACGGTCCGAACCGTGACTGGAACACCGAGTTTCTTGTCGAAGG
CCACTTTGAACAAAGGGGACTCGCTCATTTTGGTGGTGGAGTACCAGACAAACGCTTTGTCGAGCAGTTGAAGCTCGTCAGCTGCCGTGGAGAGAGACTC
GACGATGCCTCTCTGCTCCTGAGTCAGCTCTTCTTTCACAAGCACCACATTGACCGCTGTCGCCACCTTCACAACCTGATCACCTAGTCGTGCGACATCG
TCCATGGAGCGAGCGAGCACTGGAATGTGGCACCCGAAGAGCCCTTCGAGCGCGTCCTCGACTTGGTGTTCGATGGCAGACACCGAAGACTTGTTTTCTC
CGGCGGGTGGGTCGAAGATGACGTTCCCGCTGGCCAGGAACGTCTCGACGTTGCCGAATCCTGCCTTGCTCAATGCGTCGGCAATCGACTTCATGCTGTG
CACGCGGCCTCCGACGTTCACGCCTCGAAGGAACGCCACGATCTTCCTGGTGGTGTTAGTCGCCGACGTAGTGTCATCGGATGCATGCGCTGGTGGGCGT
GTGTCCTCAATTGTGGTGGGTTCGGCAGCAGCAGCAGTAGCAGTAGCAGTAGCAGCAGTACTAGCGCGCGTGACTCGCTTGACTTTGGCTGGGCTCTCCG
TCCCAGCAGATGGAGCCTTCCTCTTGCCAGCCATCGCAGCGGCGACTCTCCAGCGAAGGTGAGAACGGGCTACTGAGATCCATCACAAGCCATGCCTCTG
CCAGGAATGACACGCTCGAGTACCAAAGCGCAGCCATTCGGGCGAATCCTCACTTGTGCAACTTGCAAGATGCGGTCTCTCTTCGTCCACATCTGTCCAC
CATATGCAGCCTGCATAATCCTATTTAAGTCAAACATATAAGGTATCATCGTCAAACTATACATTTGTAAGAGTATCTATATCACCCTCTCTATTGCTCG
CCCGTCTACTGCAATCCCTGTCTAATAAAGCGCGTTGTTCCGCCCTTCTTCGCAGGCGGCGTATAACCGACTCTTCCTCGCGGTTCTCGCGCTTCAAGCG
TCTCTCTCTCTGCCGAGGCGTCGCCCCCTCCGCCTTCGCTGCCACATCAGATCTTGCCTAGTCATGACCACAGGCGTCGAGCCGTCGTCGTCCGCGACCG
CGTCGTCCACGTCCTCCTCCGTGACGGACAACAACGCGTCTCTGCAGCAGTATATCTCGGCCAAGGAGGTGGCGCAGCACCAGGTCTTCCGTCAGCACGA
CTTGCGGCGCTCCATCAGCTCCACGCAGTTCAGCGGTGCCTCCAGCCCGGCGGCCAACGGCTCCAAGGCCTCGGCCGCCGGGTCTTCCATGTCGGCCTCC
AGCAGCCCGCGCTGCTCGTCGCCGAACTCTTTACCCGTCGCCGAGTCCATCCTCAAGGTGGTGCTCATCGGCGACTCTGGCGTGGGCAAGTCCAACCTCG
TCACGCGCTTCACCAAGAACAAGTATATGCCACACAGTGTACAGACCGTGGGCTTCGAGTTCGCGACCAAGACCATTCGCGTCGGGGACCGACGACTCAA
GGCCCAGATCTGGGACACTGCAGGACAGGAGCGATTCCAGTCGCTCACTGCCGCCTACTACCGCAACGCGGTGGGCGCCATGATCGTGTACGACATCACG
AACCGAAGTTCGTTCGAACACGTCACGGGGTGGCTCGCCCAGGTGCACGAGCACTCGCACGAGAGTCTCGTGCTCATTCTCGTCGGGAACAAGTGCGATC
TGGCGCACCTGCCGGAGAGCAGAGAGGTGTCGACGCTCGAAGCGGCGAGATTCGCTGCGAAGCATTCGATGGAGTTCCTCGAGACGTCTGCACTAGACTC
GACGAACGTCGTTGACGCCTTCAAGAAATTGATTGTGCCCGTGGGGCGCCTGCTGTCGCCAACCGAGCCAAAGAAAATCGCGCGACTGCCGACAGGGTGG
CGGCGCGTGCTCTCAAGAACCAGGCCTGGCGAATACTCGTACGAGAACCAGTACACCAAGGAGCGGATCTCGTTCGCACCTAAAGAACCGGCGAAGCCGT
CGCAGCAGAGCTTCCGAGCGTCGAACGGGTTAAAGAGGGTCACCGAGTGTTGTCACCGTCACACGCGAGAGCCTCCAGAGGCAGCATCAAAAGGCGTATC
TCGCACAGAATCAGACACCCCAGTGCGGCGTCTGTGCAAGCAACTGCACTATATTGTAGTCATCGGACCGATGATGCACGGCTTGCCTCCAGGTCATCAG
CCCACAGGCAAACCGTCCTCTTTTTCTCCACCAAGCCAATACAAGTCAATTACAGTCTGCGTGCTGACCCAGGAACGTCGCAAGAATGCGAATGGAGGGT
ACAGGGTCGAATAGAAGCAGGCTCACTCATTGGAGATGTATTTTCTTCAGTATAAGGCTTCGCGTTGCTGCGTGCAGCCGATCGCTGTGGGTGTTGGTTA
GCCGCCAGTTTTGTGCCTGCTATCCTTTCATAATGCTGCCGCACACATCTGGCAATATTAAGTTTACAAACATGATGGACATGGTTGGTTGGTCTCTATG
AATGTTCCCACCAGATAATGCTGCTACTAACCACGCACTGCTCATCGCTCGCTATTGCATCATCCTACTGTTTACTTCGAGCGCCGCGCAACGAAGAACG
CAGCAGCGACGGTCGCAGCAGCGAGCGCGAGAGTGGCGAGCTTGCACTCAGTCGGAGCCGACGTCCACAGCCAGGCACACTCACTGGAAGCCTTCTGGTT
CTTCTTGGCAATAATCTTACGAACGTGCTCGGCCACAGTAGCGCTCGAGTTGCTGGCGACCGATAGCCGTGTAGGAAGCGACTCCAGTGACTTGAGAATT
GGGTGCTGCTGGATCTCCGCCTCAGCCACACCAAGCGCCTTGGACACCACCGGAAGGAATTTGCCGTAGTGAGCAGTGCCAACGACGACAACCGCCGAGT
CGGGCTTGTCGGCTAGCGCTTCCTGGCCGTAGTGCATGGCAGAGGCCGCACCAATGGCGCTGTGCGGGTCGAAGAGGTAGCGGTGCACCTTCTTGTACTC
GGCGATGGTGGAGCGGACTTCGTCTTGGAGCACCGCGTACGACGCCATCTCGTTCTGCGCCTTGGTGAGCAGCTCACCCGAGATCGTGAGCTCGCTGGTC
TGCTCGAAACCCTGCATCCAGCCACGCAGCACGTCGTGGTTCTCACCGGACAGCGCGAAGAGGTAGCGCTCGAAGTTGCTGGAGACGCAAATGTCCATAG
AAGGCGAGATCGTGTGCTCGATGTTGCGGCGGTGGTACTTGCCCGTGGAGAAGAAGCGGTGCAGGATGTCGTTCTCGTTGGTGGCCACAATCAGCTTGCC
AATCGGCAAACCGAGCTTTTTTGCATAGAATCCGGCAAGGATGTCCCCAAAGTTGCCCGTGGGCACCGAGAACGCGACCTCGCCCGTCACGCCCTGCTCG
CGAGCACGGAAGTAGGCCCAGACGTAGTACACAATCTGAGCCAGGATGCGCGCAAAGTTGATGGAGTTGACGGCGCCCAGATGGTACTTGGCCTTGAAAT
CGGCGTTGGCGAATAGATCCTTGACGATCGCCTGGCAATCGTCGAACGTGCCCTTGACAGCCACGTTGTGGATGTTCTCGTCCAGCACCGTGGTCATCTG
GCGCTGCTGGATAGCGCTCACGCGTCCTTCCGGGAACAGGATAAACACCTCCACATTCTCCTTGCCGCGCAAGCCGTAGATGGCCGAGCTGCCGGTGTCG
CCGGACGTGGCACCAACGACCGTGATCTGGTGCTTGGGGGCGCCCGCGGGCAGCGCCTTGTTCTTGCGCTGCAAAAAGAACTCGAAGAGGTTGCCCAGGA
ACTGCAGCGCGATGTCCTTGAAGGCGAACGTGGGACCGTGGAAGAGCTCGAGCACCAACAGCTGGTCTGTCACCTTGACCACGGGCGCCACGTCCTCGGC
GCGGAACGTGGTCGCGTTGTAGCTCTTGGCCACGAGCGAGCGAAGCTGGGCGCGCGAGATCTCGCTCTCGTTGATGAAGAGGCCCATGACCTCCACGGCC
AGCTCCTGGTAGGAGAGCGACGCCCACTTGGTCAGCGCGTCGGCCGGCAGCGTCGGGAATTCGTCGGCCTCGGGCACCAGCAGGCCGCGGTCGGCCGCCA
GACCCGTGAGCACCGCCTGCTCAAAGCTGAGACCGCGGACGCCGCCGCGCGTGCTGCGGTAGTGCACCATTGTGTGTTGGGTTGGGTTGGGTTCGGTTAG
TGAGAGTAACGCGGCGAGAGCGCAAGTGACGCAGATGAAGCCGCCTGCTTGGGCTCGGGAAACTTCTTGTGCACTGGAGGACGCAGGGCCCCGAAGTTTC
GGGTAACATTTACCGTTGTTGCGCAAACATGCGACGTGGCGCAGATGTTGCACGAGGTGTGGTGCACACCACTTACGGCAATGCTCATGAATTTATAGCT
CAAGTTATTGCTGACCGCTACCGATTTACGTGTCTTGATCTGCCATTTGACAAGGAAGGTATGAATACCATGGACACCTGCATTGCCTAATCGTGTCGGT
TCGTCGGCTTCGCTCTCCAAGACATGCAGAAAAGAAGCCGGCACATCTTCAACGAGAAACCGGGAGAGCAACAGCCTGCTGGATAATAAAAAAGCAAACA
GGGAAATATATTTCGCATGAGTACTATCTCCCCGGGGTGTTCCACAGACTTCTCCTGCCGAGAGCTTTCTTTTCGTCCGCTACCTCATTGGAATCCGCCT
TCCGTTACTCTCTACCTCATCGCTCGTGATCGCAATCAGTTCTGGCCAAACTGGAACATGGTGGGCTCGTTAGAGGACGTGCCGAACTGGAACTGCTGTG
CGTTAGCATCCGTGTCGGGCGCTAGGCTATCCTCCGCATCCTCCTCGCCGTTGAAGAATGTTTCCACGATCTTCATAGACTTCAGGTAAATGTCTGTCAT
CGGCACGCAAAGCAGTTAGTAAGCATGCAAGGCCGGACGACTCAAGGTAATAAATTACCTTCGTTGGCGTGGTACTGCAGCGCCTGAATCTTGTTCACAC
CGTCCGCCTCATCAATCATCGTTGCGATGTCGTTAACGTCGTTGGTCTTCTGCGCCTCGCCCGCACGCAGAATGTTCTCAAGACCCTCCAGGGCCACAAT
CACGACCTTCGCGTCCTTCACTTCGAGCAGGTCGCACAGAGGCTTGATGCATCCTGTACAAATCGACGACACAAGGTACTGTTAGGTACAGCAACCCAAC
TGCAAGTGTTCATTTCACTTACCGAGGCTGACGAGGTGCATGATCTGCTCCGCCGAACCTCCCGAAGTGGCGTTCGACACGGCCCACGCTGCCTCCTTAC
GAATGTCGAACTCAGCCGTTGACAGGAAGTTGATCAGGGACGGGAAAATGTCGGCCTCGATGATGAACTGAATCTGCTCCTGGTTGCCAGCCGTAATGTT
GGAAAGCGTCCAACACGCCTCCTTTCGGATTCCCTTCTTGGGGCTCTCCAGAAGCGCACGCAGACACGGCAGCGCGTTCAGGTTAATAATCACCTGCGTC
TGCAGATCGTCGCCCGTGACGATATTGCCGACCGTACGCAGAGCAGGCGTCTGCACAGAAGGAGAGTGGTGCATCAGAAGCTCCACAATTCGCCGGCACA
CGCCAGCCTCAATCACCGCCTGAATCTTCTCGTTCGAGCCGTCGGACAGGTACGACAGAGCCCAGCAAGCGTCCGTTAGCACTTCCTCGTCGTGGGTGTA
GATGAGCTGGCCCAGAGTCGGGAGCGCAGGCGACACGAGATCGAACTGCGGCTGCGGTTTGCCACGGCAGAAGTTCGACAGCGTCCACGTAGCGTTGCGG
AGCATCGTCGGCTTCGAGTTCTCCCTGAGCTGCTGCATGAGCGGACGCAGCGCACCGCAACGCAGCACCATGTCACGGCACTCGATGGAGTCACCGGCGA
TGTTACCAAGGGCCCACACGGCCTGCTCACGCACATCATCGTTCGTGGACAGCAGCAGCTGGCAGAAAATAGGCACCGCGCCGTGGTTGATCACCACCTC
AGTATCCGCAGAGGTACCCGAAGCAATGTTCGTCAAGCCCAGGCCGCCTCGAACTGCAGGGTCGGGAAGTCCTCGCGCTGAAGGAACTGCACAAAAATGG
GGACGACGCCAGTGTCGATCACCTCCTTAATAGGCGGGTTGCGCTCTGCGATAACAGCGTAAACAGGTCAGTCAAGTCTTTTTTTGCCACCTCGCACTGT
AGTCTCTAAAGCTCACCAATAGACAGCAGCTTGCGGAACTTGGTCACCGCCTCGAGCTGCACGTCCGCGTCGCTGGACTGCACGCCCGTCACCATCTGCG
GAAGCTCTGACAACTACACAACCCACCAAACGACTCACAAATCAGTGCGCGCCTTCTCACTTCGCGTCCAGCGCCTGCTTACCCGCTGCATTAGCGATAG
CTCTCCGGCGGCGTCTCCCATACCAGTCGTCGCCGCAGATCCGCTGTCCCCAGGCGTCTACATGGCAGCCACAACGAACAGTGAGTCTTCTCCAATAAGA
TACGAAAACGTCTCCAGGCTACGCCTGTGTCTTCTACTACAAGGCCACAAGCCGATCGACAAGAGAATCCCTCTGCTTCTTTCGGTTGCTAAGCGTCTGC
TACTGCTATGCGTACCATGCGGCGGCGCTGGTTCATGCGGTCCTCCTTGATGGTCTTGCGGATCTGCACGGTGGTCTCCATGCGGCTGCGACGCGACTCA
TCCGAGTCGATGCCTTTCTTGAAGAAGTTCTTGCGCTCCGGCGCTTTTCCGGCGGGGAACGACATGGTGCTCGGATCTGTGCGTGGGCGCGGCGGGCGGA
TCGGGACGCAACTAGCGACTGCGCGGCTTCTTTCCTTGTTTCCCCTTCTCGAAAGCGCGCGGTACTGGCGTGGACCACACCTAGCTTTTTTATTGGCGGG
CCTCGCACGACTTTTCGCAACGGAAATGATTGGCATATTTGGCCGTGTCTATTCTTTTTAAAAGAAGCTATCATTACGATACGCAGAGCGGTAGTACACA
GAACCTGCGAAAACGAATAGCCAAACGTCACGGAGAGGGTCGGACCTTCAAGCCCCGATGATGAAGCCCTCAAGCAGACCGAAGCTGTTGCCCGCCACAG
ATGCGCCCACATCGTCGTCCTCCTCCACACGCAGCGTGGTGATCCACGTGTTCGACGAGTACCGCAAGAGCAGCAAGGAATTCCAGTGCCAGCGCGACCT
GCTGCTGGCCAAGATGAAGTACTTCCAGGCGTACCTGAACGAGGCCAACGAGCACGACGAGATCGACATCTCGGTGCACTGCGACGTCGAGATCTTCGAG
CTGCTCATGGAATACATGCACCAGCGCGACCACGAGTGGCGGCCGCGCATCACGCTGGAAAACATCGCGTCCATCCTTGTCTCGTCCGAGTTCCTGCAGA
TGGAGGAGCTCGTGGAGGAGTGCGTGGCTTTCATCTCCAGCCGCGTGCAGGACTTCATGCTACTGCGCGTGGACTTTGGCTGCCTGTCCGACACCACAAT
CGCCAAGATCGCTAACAACTGCACGCCCGAGCAGCTCCAGACGCTGCACGACCCCAAGGACAAGATCCTGTCCAAGCTGCGGCGAAAAAAGGTTGAAGTG
CTGGTGAAGACGCTGCAGCACAGCGGGCGTCGCATCGAGCTGTGTACGCACTGTGAGCTGCTATTCATTAGGGACGATAGGGGGTGTCTAGGATGCCAAA
AGGGTAAGCGCCAGATCGGCGTGCATGGCGAGCTGGTCGGAAAGCACCAAGCGAAAGCAGGGTGGCAGGTCGAACTATTCCTACGCGAGCTTGGCATCGT
CAAGAGTATTTCGTGGAGCGCGGTTTATTGGTACATCTGGGGCTCTACCAAGTACTTCCACTGCAGCGTCTGCAAGCAGAGGTGCAGCTTGCTTGAGCTG
CGTAAGTGCGCCTATCACCCAGGCTCGATCGTCGATTACGGCCCCGCTGCCAAGTTTTCCTGCTGCAGCGCGAGGATTTTCAGCGCCGACGAGATATCAA
TGCGCGGATGCAAGGCCATTGCCCACGTTCCGGTTCAAGGCGCCGATAAGCACGCAGACGTTCGCAGCTTCAGCAACGTCGTGGCGCTTCCCAACATGTG
GGAGCAAATCCACGCGTGTGAGAAGGTAGCGACGGCCCAAGGCCCTCCACCTATCGGAGACGCAGGCGGCGGCGGAAGAGTTGACGTTGCCTTGCTCTTT
CCTCCGCCTCAGCCGAGGAAAAATAGCTCAAATGCTGTGGAGCGTGAGCCATCGTCCAGAAAGCTGAACTGTGCAGGCGAATGCAACTCGTTGGGCTACA
GGAAGCAATGCAAGGTGCTGCAGCTGCAGGAGAAGGATCGAATTCGCTGCCAGGACATCGCGCGGCAGCTGGTGCAGCAGCGCCTAAGGAAATCTCGTCT
CTTGGACCTATAGCGCCCGCAACCGCGATGAAGGCAACACCGCTTGGGCTCGACGGGGTTAAAAGAGGATGTTCTTGGCCCTGTTGAGGTATCGGTCCAC
TACCGCGCCGCATAACGCGCACTTGTACACCTCGCTGCAGTGAGTAAAACTAGCGGCCTCTCCATGGTGGTTGGCACGTGCACCCCCAGGTTGCGGCGGC
GGCAATCTCCTGTTGCCAGGAGCGGAAAAAGGCAACTCGCATTGTACCCCGTTACGGGTACACCGCTACACTGCTCCTGTAGAATCAGAACGGAATCAGC
TCGGTATGATAAGCGGTTGGCAGTTGGCAGCCTGAGCAGCGATGTGGAAGCGACCGCTGCGCGACGTGGTGGTGCGCTGCCATGTGGGCAACTTGCGCGT
GTCTGGGGTGATGGCACGCAACGCAGTCGACGAGGTGGCACGACGGTGGCGACTGCCGCTTTCCTCCGAAGGGACGAAGCTCTGGGGAGAGTACATGGCC
GGCACCACCATGCTCAGTTCCTTTTTCAAGGGCGAGGAGCGCGTTAAGATGATGGTCAAGACGCCCAACATCCAGGAGCTCTACGTCGAGGCCATGGCCG
TTGGAGAGGTGCGCCCCCACAGTATTATTGAATGGCATAGCAGTGTGCAGTAGCTCAACGACGTGCTCATTGGTTGGTTAGGTCCGAGGCAAGGCTATCT
ACGTCGACCAGTCTCTCGCTGGCGCGCTGGAAACGGGAGGGCACATGCACGTCTCTAAGATTTTGTACGGCGCGGCCAAGCCGTACAACACTTCTATCGA
GGCGTCCGGAATGCCGGAGCTGGACTGGCAGAGATTTTTCGACGTGTCAGAGCAGGTCCCGACCATTGTGCGTATCGATAGCGAAGCTGCCGACGACCAC
ACACGTAGCTGCGGACTCATCGTCCAGAAAATGCCGCCGACAGAGGCGCATGAGCGCCATTACGAACTAGAAGAACTGGCCTTTGACAAGCTCCCCTTCT
TCGCTTCTGAGTTGAAGAAGAATACGGATCTGGTCGAGTACCTGAACGAATTGATTCCAGGCGCCGATATCACGGACAAGAACTGCAAGCGCATGCCACT
GGATTACTATTGTCGCTGCTCCAAGGACAACTACGCGCAACGACTCAAGGACATGGGCGCAACAGACTTGAAGCAGATTGCAGCGGACGTGGGCAGCGCT
GGCGTCGATCTCACCTGCCATTTTTGCAATGACGCATACCACTTTTCTTCTGGCGAACTGGAAGGTCTGATCGAGTCGCTGCCGAAGGCATAATCAAATA
CGCTAAAGCAACGAGGTAGTATATCGACATGGTTATAGAATATGACGAAGTCATCATCTATGCGTTTGCCTAGCCCTCCTGTCCGAACTCCTGGGTCCAC
TTCACGAATTGGCTGAGCTCGTCCGAAGCAACAGTAGCGGTAGAATGCTCCAGCACGCGTGTAAAGTCACTCTGCAGTTGAAAACAAGACGACACGAGTG
AGTCAAATACTAATCAAGACCACATCCAGAGCGAAGCAGACCCTTACCATTGAGATCATCGGCGGCCGCAGCTTTTCATCGGAGTAGCCCCGTTCTGGCA
AATCGTACAGACGCATGCGTAGCGCACCACAACGTCGACATGGTGCCTTGCAGTCCGGACACTTCGGACGGCACGTAGAAAGCTTCATGTGACAGTATGC
GCACGGTGGGTCACCTTCACAGGGTGTCAAGAACGGACCGTTCCGAACGGGGTGTGCCTTATCATTGCACTGCAAGTAATGAGATTTTTGATGCTGTCAG
TAAACATTCACACCAAAATCGGATGAGTTACCGCATCCTTACCGGAGTAAAGAATTGGGCTTGTTGGCACTTCCGGAGGGGCTCCATTAACGCATCTCGA
ACAAGCACCGAGATATCTGAACCAGAGCAACTAAGAAGATGCAAAACAAATACAGCAACTAATATCAGCTCGATGTTCCAAAAAACACCTTGGTGTTGCA
ACGTACCCGTCTGTTTTTTCCGCAATGGCAGTGAAGTTTGAATCGCTTAGCTCATTCGGAGTATCGCCCAGGTGGATTCCTAGCATGACCTTGCGTGCAT
CCGTGTCAGGAAGAGGGATGTAAATGCGCTTCTCAAATCTGCAGACAAAAGTTCAATGTCAGCTATCCGCAAACAGATGCCTGTGCTTCCTTCAAACAAT
CATATAAAGTAGTACGGATTTACCGTCGTCGCATGGCTGGATCAAGCTCCCAGGGTACGTTCGTTGCCCCGAGCACCAGGACACCGTCATGATTGTTGCC
CATACCCTGCATTTGTACGAGGAACTCATTCTTGATGCGACGCGTAGAGTCACTCTCGCCCTCGGATCTGCTCGAGCACAGCGAGTCGATTTCGTCTATG
AAAATGATAGCGGGTTTCTTCTCGCGCGCCATCTCGAAGAGGTTCTTGACAAGCCTGCACGACAGCGCATACATCTTATTTCAGCTACAGCAGCTCAAAT
TCGAGTTTCATCACGCCAATGCGAATCATACTTTTCGCTCTCGCCTTGCCACTTGGAGACCAGACTGGAGGATGAGACGGCGAAGAACGTGGCGTCTGCT
TCCGTTGCGACCGCCTGTGCAAGGTACGATTTGCCTGTACCCGGCGGCTACATCAATAAACAGCTTAGTGTACACCATGCTTCCCGACTTTTACGGCAAT
CACTCAAGAGCGCACCCCATATAGCAGAATGCCCTTCCAAGGACGGCGCTTGCCCGTGAACAGCTGGGGGAACCGTGCAGGCAGAATCACTGCCTCTTTC
AGCGCCTCCTTCGCAGCATCCAGTCCAGCAACGTCGTCCCATTTCACATTAGGCTTCTCCGTCACAACCGCCGCTGCACAGAATCGTTCAGAATGTGCAC
ATCAGCCACAGCAAACATGAAGAACCCATACTCGGAATCCTGAGTTACTCACAAGCCAGGGAACCACGTAACTTGGCTGTCTCTGCGTCCGTCTCATCGT
CGTCTTCCTTCTCCCCCCTATACACAGCAGCAACCTCAGTATCAAAACAGCACCAGCACAACTTGCACGGCAAACAAACGTACTTGTCCATGTCCACGGC
GGCGGCCACCGCCTTGGGCGCGTTATCCTTCTCCAGCATCCCCCGTAGCTGCTCCGCCCGCGTCATGTAGCCCTCCACCCGCTTCATGATGATCTCCTTC
GATGTCGGATTCTTCTCGTCTGCAGGGCAAGAGTCAAGTTAGCTGCATTGCAACATTGGAAGTCGGTACCCGTACGCCTCCTCGCTGGAGCTTCAGACGT
ACATTTGACGCCGACCATGAAGTGCTCGAGTGCCTTCTTGTACAGGCGGAAGGCCTCCTGGTAGTTTTGCTGTTGTCCTCATTGATGGCGTGCGTCACGA
TCTCGATCGCCTGCGGGATGAACTTGTTCTCCATCGCGGCACCACCTGATCAATGCGGCGCAAACTCAAGTGTAACATGTAAGAAAATCCACGCGACATA
CCATAAGCCAAATTCCGTTTGTTTGACATATCATAGGCCAAATTCTAAAGAAAAATCGCAAACTGATTTTTCCGATACAATATCTCTGTTGGATTATCCA
ACAAGATCGGATGAAAGATATCTCCATGTAAAGGGTCATCCTGCTGCTTCTGGCTGCAATGGGCGTGAGCCAGTCGAAGGGCAGTGGCGCCGTGGGGGTG
CGTTGGAAGCTGCAAACGCTGGTGCCTCGGTCGTGGGGGGAGCTGGAGCAGCTGCATCTGCGTTTCCAGCAGGAGGCCCACCGCCGTCGAGCCGACCCCG
TGTTCCAGTACTTCCTGCCGTTTCCAGTGTTCCAAACTATCGTGGCGCCGCTGTGCCCCGACAAGGACAAGTTGCATCTGCTTGCCATGTTCGAGGCACT
AGATGTCAAGACGACGAGGAAACTGGCCGTGATGGACTTCTTCAGTGGGCTGGCGCTCTTGGTGGATGCCAAGAAGCCTCAGAAACTCGAGTGTGAGGCG
ATGCACCGGGCGGTCTAAAGCACTAGTCCTAGTGAGGGTAGCTAACTCGTACGCGTGGCTCCAGTTGTGCTGTCACTGCTGGACAACGGAGGCCTGAAAA
CGCTCAACAAATGCGAGTTGACGATGGTCGTGTCTGCAGCGGCCAGGGGATTGAAGATGTTCGCGCCTGAAGCAGACGTCTTGCAGGAATCAACCATGAG
GCCGCTTATTCGCCGTAAGGACTGCGGCTATGATTTATGCACCTGTGTCAGCTTAGCGTGTCTGCTTTGCTGCAGGTCTGTTCGGAGACAGCAGCGAGGT
TCTGCGGCAAACCATCGTCAATAAAGCTCTCGCAGACCCTGAAATCCTATTTTTCATGAGCGATCTCGAGTCGGTAAGTGTCTATAGTTTGTAAGCTTGC
TCAATAGCGCTTGCTTGGATTTTATTTGTCTGTACTGCATGCACAATAGGGTGTAGCGACGTCCTCCGATGAGTTGCTGATTCAACAGGGAAAGCTCATG
AGGCATATGGCCTACTTGGACTATCAAGCCGCACGCGTTAAAGCGTCAGGTATTGCAATATTCTTGAATGTATACGTCAATGGAGTCCAGCTCATCTTTT
TTGTCATTGTAAGAGGAGCGAGGAAGGACAGCAGCGGCAACTGCTCCCATGAGTGGAGTCGGTGAAGAAGCCAAGGGCCAGCAAGCCCTGACAGTGACAT
TGGTCCCCACAGCAGAAAGTTTTTCGCGCAGACTTCAGAGTATTGTGTGCCCACCCCCACCAAATGGGTCAGACCAGTCAATGCGCGTGCTATCTGCAGT
TGAAATTAAGAAGCATGTTGACCCACGCACACTCCAGCGGTTGGTCAATATTGTTTCAGATGGCGGTCTATCGCTCTCATGGAAAGAGGTTGATTTGCAC
GGCAAGTATCCTACCTTCATCGAAAATACTGATTTATGCATTGCTTGTCCCCCTTCAGGCTGAAGCACTCTTGGGCGATATGACTTCAGACCAGTTTGGG
CTTGTACGGTGCGGCGACATTCTGCGCGTCATGAAAGCTTGGGTACAGAATCGACGACGAGAGAAACCAGAAGCACTGTGGGAGTTTGTGAGCAGCTACG
TGGCTGACGGTGTTAAAAGCATCGAGAAGCAAATGAATGCTGTTCTTGTTGCGATTGTCAAAAGAGCAACGAAGGCGCTGGGGCCTACTGTGCGTCAGCG
GACGGCTGTAGCTAAAGAGCATTTGCTTGAAAGCTTGCAGAGCGTCGCACTAAACCCTGATACTGACGATGGGGAGCTTCAGTGGAGTCTCAGCATTCGA
GTTGGCGAGACTGGTCTGTCGGTGCTAGCGCCAACAAGCTCTCCGCCTTCGAAGCGTCTAGGCGCTCCTTTAGGAAATAACATCAGATTTCGACTAGGGA
TTCATCCACCGAGTAGTGCAGATGGTGATATCGGTGCTAAGGCCAAGTTCGAAAACGAAGGGCAAGCGAACAACGACAGTGACGAGCTAAAGGATATTGA
TTCGGAAACTATGCGCCTTTTTGCCAACTTCTTACTAAACCCCGAAATCACAGGTAAGGACCGCCATCTTGATTGCGCTGTGTTTTTTTTAAACCCAAGT
TCTATGCTTGATTAGATGAAGAAGGCATCAACTTAGCATCATCGGTAGAGAAGGCATTGCAGCAGGAGCTGGTCTGGTCATCATTTGCATCTCTATGGAC
GAAATGCTCGGGTTCGGACTTACGATACGGAACTGTGACGGGGCTATGATGTGGGCTAACCTACTTGTATTTTGTATAATTGTTGTAGTTACAATGCATT
CGGCAATTCGAAGTGACAGAGGAGGACAGCCTGTCCTTGACCAGTATCTTCGCGTCTGTATCAACTTCCGCGAGGACTTTATCTCGAGTGTGGAGGTAAG
CTACCGCGCTGATAAGCGTGAGCAGACAACGTTTTGGGCGTTGATATTCACGTTATATTCATTGCGCAGGAGTGCACAGGTACATCGTTCGCGGTTGGAA
TTCGTAGCTTCTTTCTCTTGGTTGAACTGGAGCAATCTTTGGTGGATATTGTTGAGGCTTCACTGGATATGTCTGCGATGCTTCACAGTCTTGGCAAAAG
GCAGAATCGACAACGCGCGATGAGGATGATTTTTGATGCATTTGATGCAAACCGTAGCGGCGAGTGGAGCCTTCAAGAGTTCAACACTTTCCAGCAAGCA
CTTGGAAAGGAAGCTCTGCTTGAAATCACCCTAGCGGAGTTGTTTGGCGGATCCTCGTCGATTTCATTCGACCAGTTTGTTACAATCTACGAAAATTACC
CAATCGCCAAACTACTCGAGATGATCCGTCAGCTAGAAATTGGTAGGGGTACCTATTCGTGGTGGAACGTTATGGATTGCTGTACTCATGACGATATTGC
TGCAGGCTCGCTTGGCAACATGATAAAGGGTTCCGTATCAATAACATCGACACTGAACGAACCATGCGTAAAGGCTCTGGGCGTGTTTCTAAGCCCGCTG
CGCTGGGCTGACGCGATGTGGAAAAAGCTGCTTCATTTCTCTAGAAGCACGAAGGATTTAAACCTCGAGCTTCAGTTTTCCACGCTTTCGGATCTCCTAC
AGAAGAGCTCTCGTCGTGTCGGAAAGCTGGATTGTATCGGGGACCCACTGTTTGTAGCATCATGGATGAACTGTCTGGAGGAATTTGTGCAGCCACCACA
TGCAGAGCACTTAAAGGATCGACCATGTCGAAGTATCTTCTGTTCGCTGGAGAGTGAGATAAACAAGACGGAGCAGCAATGGGAATTTGAGGACCAGAGT
CGGAAGCTTCCACGGGGTACATCTGCTCGCCGTGCCGAAGCCATGATTCCAATTCTGGAAATGGCAAAGCTTGTAAAAGTGCACGTTAAAGGACTAGTAT
TGTTGGAAATGCGTAGCAAGAGCATTCGGATTGTGTGCGAACTTGACAACCTCTGGATGGCGCGGCCAAGCAACAATAATGAAGAAGTCGACACTGGAAG
AAGTTGACCTTGGGTAACGCTACTTTTATATTTGCGAGGTAATAATAGGTCATTTTAGTTACGTGTCGACGTGCTCAAGGCGAGAGCGATATGATTCAAA
GAATACTTGACCTCGCTTGACCCATGAATCGTCCAGTGACGGCGACATCAGCTCACAATGATGAGGGGGGCTTGACATTTTCAAGCGAAGAGTCCAAAAC
TGCGTATGCCCAAGCACTTGAAAACCGACATCGTGGATTGTACCAAGAGGCCGTCCGAACTGGAACAGATCATCGAGGTAAGTGTGACAACGCTCGGCCC
ACGAAGAGTGGCGTACTAACACGTATTTGCTGGCAGCAAGAAGGCGACTCCGAGAAGCTCTGGACTGAGCTCGCACTTGCACAATTCCAGCTTTGGGAAG
CGCATGTCCGAGCATTACACTTGCCGTCCATTCTAGTGCTCACATCAGCAACGCAATCCAAACGACCCACAAGCGCCAGAACCGACACCAAGCCATTGCA
CATGGTGCTGCTTCAAGAAGTCTACAGCACCTTCCTCATCGCGATGGAATATCCAAACAGCAAATCAAGCCCAGAGCTGTTGCTCCCACTGGTGCGGCTT
TACATCGAGTTTGGGTCGCATCGGGGTGCACTCGCCGTCTGTACACTGCTGGTCGAAGGATATTCAACGTCTCCACGCCTCAATGAGGCCATTTTCTTGT
CGGCACTTACAGCATCGGCACTGGGGCGCCACCGTGAGAGCGCACAATATTTCCAATACCTAGCGGAGGGGCCGGGGCCGTCGTCATCGTTCCCGTATCG
CCTTGCTGGCTATCAACTGAGCCTGCTAGCAGCATTAGAGCTAGCCCGGGTGCCAGGTATGCGCGCACTGGAGCGTGAGATGTATACCCAAGCGTACAAA
GCTTTGGTTGTGCTTCCACCAGTACTGCCATCGGAGAAGACAGCCCACACGTTGTATACGACATCGAGAAAAAATGAGGAGCAGCGAACCTTACTATGGT
GTCGCGACGTGCAAACATGGTTAGACCTTGCTCAGAGACTTGCTGGACCAGCCAATGCTCCGCTTCTCGTTCTATTGGCAATTCGTGAAGCGCGGCGCCG
GTCAACAGGAGTAACAGGATTCTTTCCTACATCAAAGCTGCTACTGGAAGGCGTTAGTCTGTTGAGGACGAGAGACAGCTTGGGTGCCGAGAGGGTACTT
GGTGAAGCGATTTTGCTGCTACCTCGTGATACATACTACAGCGCGCGGCACGAACGCTTTTTACTGGAGCTATGCAGTGCCTCCTGGCGTGCACAATTCG
CCTTGGAGCACAAGAGTGCTGCACGTCTACAAGTATTGCATCGGCGCCGCCGTAAATTAGCGCAGTGGCATCTTGCTGTCGCTCATGTTCTGGAGCAGCG
TCGCCATGCCATGACGTTGCGCATTCAATGCGCATGGCGGGGTTCACAGCAAGACAGGAGCTTGCATCCTTGCGTCGAAAGCAGCGAGAGAAGGAAGCGC
TGGCTAATATGACCATGGGTGTGCACGACGACAGACTCATCGAGCTACGACTGAATGCAGCCGCAAGGAAAATTCAATCTCTGCTTCACATCGCGCGAGC
AAAGAGGACGATTCGAGTCCTGCGAGCCCAGAAAATCGAGCGACAAGCTCTCCTGGCAAAGTTTGCTGGTCGCCGGACCGAACTCGGTCAGCTTGGTGTA
TTTCGTAGATGGCGAAGCTTTGCTTCAACCCAGAAGCAAGAACGCCTTGATGCGGTCGTACGAATTCAGCGCCAGGTTCGAGCCTGGCGCAGCCGCAAAC
TCTGTTTTCAGTTGATATTGCTTCGACAGCAGCAAAATAGTGTTTTGCAGCAGTGCCTGGCACGGCGCTCGACTTCGCTCATTTCACGCGTGCTGAAAGC
CTGGCACACGGTGCTTATCGAAGCTAAGAGTGAGCGAAACTGGGCTTCACGGCTGATTCAACGCAGATATCGTTCAAGGCTAGCAGTACGCCAATATCAT
GTTGAGCTGCGGCGGCACCGAGCAGCAACCACCACCATGAATCGTATGCTTTTAAGTCGCACGCAGCAAAAGCTTTTAAGCTCATGGCGAGCCCTCGCAA
ACCACGCGCTAATCCGTCGTCTGCGCAAGCGCGGAGCTGCTGTGACTATCCAGAAACACATTCGAGGCGCACTTGCCCGGCGACAAGCCAAGCGCCTTCG
TGCACGTCGCCGCCGAGCACTCAAAGTGCTCGTAAAGCTCACACGCTCGCGCGAAATACAGCTTCAACAGACAGGATTCGATCGGCTTTGTCTACATGTG
CAAGAGCACCACAGAAGAGCACATGGCGCAGTGGTATGCATACAGGGGCTCATTCGGGGATTCTGCTGCCGTCAAAGGATCCATCGACGGCGTACGGCGG
AGATGCTGGTTCAAGGGAGCGTCTTCGGCAGCGCGCTTAAAGGGCAGCCAGCAGACGTCGTGCTATGGGCATGCTTGATGGCGCTGTCGCGATATATTCG
ACAACGAGATGCCGCAGTCGTTCGGCTGCAACGATGGTGGAAACAGCGGCAAAAGCGTGCTCGAATGATCCGAGTATTGAGCAAGCGTGCAGCTCAGCGT
CACCTACTCGGCAAACTGCAGCAGAGTTTCTACACAACTGCAAGGAGCTTCCTCCGGGCGCTTCAGACTGCTATCAACACCAAAAAGGCCCGAAAGCACT
CGGCAGCGACTAAAATCCAACGACGGCTACGATGCTGGGTGATGCGCCGAAGGTACCTTAGTACTCTTGATAAACACTCAGTCGCTGCTCAACGTGGTGA
GAAAGCAGCAAGAAAAATAGCGCTCCAAAGAGTACGCCGCTTGTATCATGGCTGGCGGGATGCAACGCGGAAGACGCGACAAGAGCAGCACGAGGCAGCT
TGTCTGGTACAGCGAACTTTCCGGCGGCACCGAGCGCAGCGGCAGGCACGTTGTGTTGTGGCAAAAAAAGCAGCACAAGCACGATTGCTGGCTGCAGCCT
CACAAAAACCGTTGGAGCGCTGCTTTCGTCAATGGGAGGCCACAGCCCTGCTCGAAAAGAGTGTGCTGCGTGTGCGCAGTTCGTCACTCATCGGCTCAAG
AGAAAGCACCCCCGTGAGCGGCCAGCGCAAGCTCGAGATTTCTTCTGGTGGTAGGTTCGACAAGACTCCGACGCTTGAGGAGGTAAGCTGTTGGCTGAGC
TCTACAAACGTGCAGCGTACGCTAACCCACCAATGTCTCGTGCTCAGCGCGCCAAGATACCGTCGATGCTCTTTTTCACGGTACTCAACCGTGTGCGTCA
GACCGGGATTTGTCAGCTCTCTTACAGGTACGCCTTGTCGAGTGCACTGCTGTTCACACAGGCAAAAACTCACTGCTCACAATGTTTTGAATTTTCCAAG
CGGCGGCACCGTGTTCAAGGGTCCTCAACTGCGGCAGTTGATCTCATTGTCCACCAGCATAATCGTCGACAGCGGTGGCGGTCTCTCCCAGCCTCCTGCA
GCTCTCTTCTCAATCTCAACGAGCAGGTCGTGGAAGCTCTGGAGGTGTGCTCCAACTCTGGCTCGGGCTGTCCAGTTCAATCGCTCATCTTGTGCAATGC
GCCGCTCCGGTCCCCCCACGCGTCCCTGCTAGCCACTGTATTGCAGCGCAGTCGCAAAAGTTCCAACCTCGCTCTGGTTCCGTGGTGCTTGCCAACGTCC
CTCTCGCGCTCACGTCCGTTGTCTCTCTCGCCTGTGCGCTGGCTCAAAGCCCGAGCTGTCTGCAGCAACTGGTGCTCGAGCGCTGCCAAGTGGGCAGCGC
CGGGGCATCAGCTTTGTTCGAGGCGCTGACCTACAATCGCGCGCTCTGGAAGCTCGATCTCAGCGGGAACCACATTGGAGACGCCGCGTGTCCCGCTCTG
GCCCGCTCCCTCCTCGCTGGCAGTGCAGTGCGCGTGCTGGCGCTCAGCCGCAACTCGCTGTCCGACCGGGGTGTACTGGGCTACCTGTCTCCCGCATTGG
GATCATCACGATTGGAGACGCTCGTGTTGCTGCAGAACCCGCGGGTGTCGTCTCTGTGCAGCGCGTCGCTGCATCAAGCTGCTGCGTCCTCTGGAGATCT
TATTCGCGTCCTTTCGGACGGCGGGTTGTGATTGGCAGATATCATGGCTACATGTAGCCATGTTGTCACCAAGAGCGTGCTGATTGGCTGAAGGCTGGCT
GGACGGAGAGCACCCTCGGTACCCTGTACGTCAGTGGATGGTTCAGCAGAACCGAACACTCCGAAGCCTCCACCCGACTCGTAGCACCATGGTCGACGCC
TCCCCCGTGACCAACCGCAAGCAGGTGGCCATCCTGGACTTCGGCTCGCAGTATAGCCACCTGATTGCACGCCGCGTGCGCGAGCTGCACGTGTTCTGCG
AGCTCTACTCGTGCCTCGTGAGCGCCGAGGAGCTGCGCAAGCACCAGCTGACGGGCATCATCCTCTCGGGCGGCCCGCAGTCCGTCTTCGATGAGGGCGC
GCCCCACGTGGCTCCTGAGGTGTGGCAGCTCATTGAGGAGCAGAAGATCCCGGTGCTCGGCATCTGCTACGGTCTCCAGGAGCTGGCTTTCACCTACAAC
GGCAAGGTCGCGCCCTCGCAGCACCCCGCGAGTACGGCAAGGCCATCGTCAGCCGCAAGAACGGTGTGGACTGCGGTGGCCTGTTCGAGGGCCTGCCCGA
CGAGTTCCAGATGTGGATGAGCCACGGCGACAAGCTGCACGCGCGCCCCGACGGCTTCGTGGACATCGCCACCACCGAGAACTCGGAGCACGCCGCCATC
GTCAACGTGGAGCGTAAGTTCTACGGCATCCAGTTCCACCCTGAGGTGACCCACAGCCCGCGCGGCAAGGACATTTTGCGCAACTTCGTGGTGACCATTT
GCAACTCCCCCACGGACTGGGACATGCGCAGCATCGCCGACGCCTTCATCGAGGAGGTGCGCGAGACCGTCGGCCCCGACGGACACGTCATCGGCGCTGT
GAGTGGCGGTGTGGACTCGTCTGTCGCTGCCGTGCTGCTGCAGCGCGCTCTGGGTGACCGCTTCCACGCGGTGCTCATTGACAACGGTCTCCTGCGTAAG
GACGAGGCCACCGAGGTCGTTGACCGTCTGCAGACCAAGCTGGGCATCAACCTCAAGTGCATCGACGCCTCAGACCGCTTCCTGGCGGCCCTCAAGGGTG
TCACGGAGCCCGAGACCAAGCGTAAAACGATCGGCAACCTGTTCATTGAGCTGTTCCAGGAGGAGGCCGAGCGCATCGGACACCCGGTGGACTTCCTGCT
GCAAGGCACGCTGTACCCGGACGTGATTGAGAGCGTCTCGTACAAGGGCCCCTCGGCCACGATCAAGACGCACCACAACGTTGGTGGCCTGCCTGATACG
ATGCACCTGAAGCTGATTGAGCCGCTGCGTGAGCTGTTCAAGGACGAGGTGCGTGAGCTCGGTATGGCTCTTGGCATTGACGAGCCCAGCGTGTGGCGCC
ACCCGTTCCCTGGCCCCGGCCTTGCCATCCGTGTGCTCGGCGAGATTACGCCCGAGGCTCTGGAGACTCTGCGCCACGCTGACTCGATCTTCATTGAGGA
GCTGCGCAACAGCGACCACTACAAGACGACGGGCCAGGCTTTCTGTGTCCTGCTGCCGGTCAAGTCTGTCGGCGTCATGGGCGACGGCCGCACGTACGAG
AAGGTTGTCGCCATCCGTGCCGTCAGCACGTCGGACTACATGACGGCCGACTGGTACCACATGCCGTACGAGGTGCTCGGCCGCATGTCGAACCGCATCA
TTAACGAGGTGCGTGGCGTGAACCGCGTCGTGTACGACATCTCGTCCAAGCCGCCTGCCACCATCGAATGGGAGTAAGCGGTATGGTGCACTCCTCGTCT
TTGCCACCATTTCTGCAGCTCCGCTCTACAGGGTTACTAGGAATACTACCGGTAGGCAACGGCGGAGGAAGACACTACCCCTTACGGTAACGTCGCGCTA
ATAGAGCAACGATACATGCATGTACACTAACCAAGATCAAATGGAGCAAAGCGGCGGGCACGCTGCCCGTTCATTTTCATGAAGTGCTGCGACTTAAGCG
ACAAGAATTCTTGGCTTCAACCGGTCAGTAGTAACGGACGTCAATTGCTCATTGAAGACGTCGCTCCAGGATGCTGGCCCTCAGCGCGTACGAAACACTG
AGTGTGCTCGGCAGTGGACAATTCGGCAATGTGGTGCTCGTTCGGCGCAATTCAGATCGGAAGCTCTTTGCGGCAAAAGTTCCCCACGGCGAGGACACCG
CAGCGAGGTTGGCTGCTCGTCAGGAGGCTCAGCTACTTATGCAGTTGCATCATGCGAACATTGTACAATTCATCGAAGTGGTTGAGGAGGATTCGCAGAT
AGCACTGGTGATGGAGTATACTAGCGGCGGAGACCTGGATACCTTCTTGCGATGGCAACAAGAAAGCACGTAAGCTCGCGAACTCATCTGCTTGAAACAT
TTTCATTTTCACAACCGTTGATGTTGCTCGTAGGGGATTTCTGAGCGAGCCTGCAATCATGCGCATATTCATCCAGGTTGTCCTTGCGCTCCAACACTTG
CACGAACACCGCATTCTGCACCGGTACGCAAGCTTAAAAGAATACTGCTCAGATGCCAACGTGTAGAGCGACCCACTCACGGCTATAAGTGCCTTGTTGT
ACATGTAGAGACCTCAAACCGAAGGTACATGGCTTTAGCTCGGGAGCCGGTTATCGTGAACTACTTACCTACATGCGCGAACGGTTCTTGCTAGAACATC
CTACTGGATGGCGACGGGATCGTAAAGTTGAGCGATTTCGGCGTCTCGACGGTTTTGCAAAGCTCTGTGGACTCTGCTCAAACCATCACTGGAACCCCAC
ATTACATGTAAGCTACAATCGTTGTGCTTCTTGGTCTAGGGTATTGTTCTCATGATGCTCGATCTCAAGGTCACCCGAAATTCTCGACGGAGATTCTTAC
GACTGCAAAAGTGACGTCTGGAGCCTTGGCTGTGTGCTATATGAGCTGGCAACCTTTTCCCCACCGTTCACTGGCTCAGCCCTTGGCGCGGTTGTGGGTC
AGATTCTAAACTGCGACCCACCGCCAATCCCTTTGTGTTATACTCCACCATTTCGAGCTCTCGCAAGCAAACTACTCGAAAAAGACCCCCGTGTACGCGA
CAAATGTATCTGATGGATGCAGCAACACTTCTAAAGCAATGTGTGTGAAATATGACAGCGGCGACCAGGTTTGCCAGAAATCCTGACTTGCCAAGCTGTT
CAGCACTCCATGATGCAGCTAGTGAGCGTTGCTACTTCGCATCAGCCCATGCTCCTGGAGCAGTTTGCTGCAAAAAAGAAAGACTGCAAAGCTTCACAGC
AAGATGAGATTACTCTTTCAGAGGTGGTAACTCCACTTCCCAGTCGTCAGGGCCTTGGTAGTGCACATCAAAACAGTGACCAAGCCAAAGGGTTCATACG
TAAAATTCAGCCGGAGACAAACGATGCTCGTCAGGTTTTCTTCGAGAACCAGGTACGATGCACTTCGAAGTACAATGCAATGAGCCATACGAATCTAACG
CGCATCACTCCTCCAGGCAGCTGCTCGAAAAAACAAAGAGCGCATCGTCCAAGAGAGATCATGTCCAGCAGTTTTCCTTGACTGCAACGATTGTAATTCG
CCAGATCACCACACTCAAGTCCAGGCGCAGATACAGAAGCCCAGCCTCATCAACAGCCCCAGTGGCCGACAGATACTAGAAAGTTTTGGGTGTTCTGTTG
CAGTAAGCAAGCCCGATATGCCGCCCGCACCTTCGTCTTTAGCTTCTGTCAGAGGTCGAGCTCAGTCGTCACCGTACGTTGTTACCATAGCTGGATCGCC
GAACATTGAAACTAACACTAATCCTTTCAGCTCAAACTACGAAGATCTACTAAATAATGAGCGACGACGCGTGCAGCTCGAGACCAAGGCGTTGCAAGAG
CGAATGCGAGTCATGCAGGCCACAGACTGAAAAAACTTCGACTTTTGCGGATCAAAGCTGTGGAGTAGCATTTAGAGTGGAAGCCTGGAAAGAGAAGGCC
AAAAAGAATGGATTATCTACTGTGGTGCTGGGCTTGAACGACTGTTGGAACCGATCACTACAGTTTTGCAAAACTTTTGCCGATCATTACTCAGAATGCA
TACATACATGTATCGTGGGCTTCGAGAATCTGCAACCTCTCTACTGATCTTCAATTGCTTGCTGCATTGGGCCCTTCATTTCGTTGCGATCCAACGCTAT
TAGTTGTGAATTCATTTGTTGGGGGTAATGTTTCTTTTCGAGTCCGAAATATACTACCCGGTAGTCATGAATAATGCTCGGTGTTGAGATTCTCATCCCC
ATCAAAGCACCATGAAGGCTAACCAGTTCGTCGAGTTCGGGTGCGTCCCAGCGCCGTCGATGCTTCAACTCACTCCATAATCTGTCCCCCCTACTAAATG
ATCCAATATCCCCACCTCCTACAGCAAAAAGATCGTGGCCATCGGAAAGAACTACGAGGCCCACGCGCGCGAAATGGGTGCGGCCTCGGCCCCCAAAGAC
CCCGTTCTCTTCCTCAAACCCACCACCAGGTACAGCAACAGTCGGCAATGAAATCTCGCGAAGGAATCGCTGAATTCTGTGACTTGTGTGGGTAGCTACG
TGCGCAATGGCGGCAGCGTGTTGCTCCCCCCTGGAATCGGCGAGGTGCATCACGAGGTGGAACTTGGCGTACGTCCCCTTCCTTGCTTTGTCAGGAGGAT
GGGTAAGAGGGTCGTGTAGTTAATAACCTGGTGGGTGCTTAGGTGGTGATCGGCAAGGGTGGCAAGGATATCACCGAAAGCGACAGTATGAACCACGTTG
CTGGCTACGTACGTACATCGACTTCACATGTAGATGAACCTTTGCTCTTTTTGTTTATTTTTTTTACTCCACTGATTTGCATGTGTTAGGCACTGGCGAT
CGACATGACGGCCCGTGATGTGCAGGCCAAGGCAAAGAAAGCGGGGCTGCCGTGGACACACGCCAAGGGGCTCGACACCTTCACGCCTATCAGCGACTTT
ATCCCTAAGTCAGCGGTACCTTCGCCTCACGACCTCAACCTCTGGCTGAAGGTGGACGACGAATTGCGCCAGAGCGGCAACACCAGCGACATGGTGCACA
ACATCCCATTCTTGATTTCCTACGTCAGTCGCATCATGGCGCTGGAGGAAGGCGATTTGCTCATTACCGGCACGCCGGAAGGAGTTGGACCTGTGCCAAC
TGACAGTGTACGTTTCTTCCTTTGCATTCTGATCCAGTAGCCACTCTCTTAGTTTGTTTATTGCTATCGTGTTGCATAAAGGTGATCACTGCGGGCATCA
CCGGTCTGATCGACGTGCGCTTCCCCGTGGAGACGCGGGTGTACAAGGCGTAGGTGTGCGTTTGTACTCCGAACAATAAATGGCACTTTGCTCAAGTAAA
GCTGCTCGATTAGCTGCAAGCTACAATTCGAGCCTTGGATGTGGTGGAGATGAGTACATTGCATGGTGTTAAATAGTTCTAACGCTGTTTAATGGGGGCT
GTCGCTGCTTCAACCAGCATAGACAACTTTCGGAAATTCTGTCTGCGTCTGGAACCAGCGAAAGTCGTCCGGACATGCCAGCCGCGGTAGATGGCCTGGA
TACGCAACGCCGCTGCATCATGTCGTAGGTTTCGTACTGCGGACTGAGCATAGGAACGCACTTCTGGCCGATTTGACGGTGCTCTAATCAGCCGCATCAG
CGCACCCAGCACACCGCTCTCCACGAGTCTCGAGCGAGCCACATGCAGCTCGGACACAGCCGCCAGCGCACGTGTAGCTTCCACAAGTAAGGCCTCACTC
ACGCCCCTATCGCTGCTGTGGCCAACTGTATGACTTCGATCAAGCGGACTTACGTATCGCACTAGCACAGGCAGGAGTCCAGCATCCACCAGCTTCAGTA
CATTTTCCGGGCGCTCGGCGAAGTTGGCAATTATCTGAGCTACGTGAAGTCGAGTGGAAACTAGCGGATGGAATGCAAATTGCCCCAGTGCTGACAGGAG
CGCGGGCTTACAGAGCGTAAGACGGGAGGGTGCGTCATGAGTGAGCTGAGCGAGTGCACCTAGAGCATCCACTTTCATGCCAAAGTCATCGCCAGCCAAG
ATGCCAAACAAGCACTTAACGACTCCGCGTGCCAGGAGCTCGATATAATGCTGATAGTCACGCTCGGAAGCTTGGCTTGCTTCCCATGAGTGTGCTTGTG
GACTCCCAGCCGGATTATCTTCAATACCCTCCGTATTCGCGGGATCTTGTCGCCGTTTGCGTTCGCTGCAAATTAACAATGTGAGTAACGTGATGACTGC
ACGGCGGACGCGTTTATCGGGTGAAGCGTATAATTCACGAGCTCCGATATGATCAAGCACCTTGGAACGAATAACGTGCTCTCGGTTTGCGGTGTTTTGA
GCTATAGCGCAGAAAATTACCAGTGTTGCTCGAATTACTGCGGTTGCCTCGGACGCTGGCCACATGGATGCAGACCGCAAGCGGGGGCGCGTTGATGAAG
CCGATCGAGGCCGGGAAGCAGACATCTTTGACTGGATTGGTGTCGCTGATGCAGTGCGCGGGCGTTTATCGCCTGCATCGGTTGACAGGCTGCTCGGGGA
AGAAAAGCAGAGCTGAACGAGCCTCGACATTGCTTCAGCTTGTACAAGTGCCTCGTGGTTAGCGTTATCTTTTGCGACAGCATCAAGAATGGCCACCACC
AGCAGACTCACTTGAAGCGAGGGCCTAGAAGCACAAGATGACCCGCGACCTAGTACGCTAAGCACGCAGGGCAGGAGCCCAAGCGAAGCGAAGCGACGAG
CATTTTCCGCTTCGGATAGTAGCAAGTGCACAAAACTCAAAAGTTCGCGGCGGAAGATCGCGTCCTTGTCCAGGAACGGATCTCGCAGCAGCCCCGACAG
TGTCGTGAAATGGCCTGAATAGTAGAAGAGCACTCGGTTATCACATGAAGCTGCAAGCTGGTGTAACACGGATGCCGCTAGCGTTCGCGTGCGTGTATCA
CTTGCCCCAACATTCCTTGCACTCTGCGGGACGCCACTGCCAGAGCAGCAATTCAGCATAAAAGCAAACCCTTCACGTTTGGCCACGGCTTCGCGCCACT
CGTCTGTTGTCACCAAGCGTGCGACGACTTCGAAACCAGCCAACCGCAACTTGTGGTCTGTAGTAGTGTGCAACAGAGAGAAGACGCAGTCAATGCCCCC
TGGTGCTTGAAGGAGTTTGGTCTTGATTGTCGATAACCGCACAAGCGCTGCCAGTGCTTGTGCACAGTCGTGAGATATCCCCGAGTCTTCACGATCCACC
GGCGAACTGAGCATGGTCAAAATCGCACCGAGCGTACCAACTTCGTCAAGTAGCTCAAGGTTCGCGGCTGCAACACAAGGGAGAGATTAAGGTCTGACAC
CAAACACCTCAATGGACATGAAAATGAGGAGAACGCACAATTACGACTGAGAGAGGCTATCGCGGCAGCTGCATCACGACGTACTTCGACGAAGGGAGAC
CAGTAAATGATCTCAATCAGTGGGCTCACGTCATCGGCCTCAACGTCTTGACGCCGAAGGCTTTTGAGGACATGGGCACTGTGAAGAGAATCCCGACGGC
GTTCGCCCTGCATGGCATTTAATTCAGCCTCGCGCGCTAGTAGCTGCTGTCGTTTTGGATCAGCTCGAAGAGATACCTTTTCAGGCGGGCCAACGGCATC
AGCTTTGGTAGTTGGAAGCTGGTGCCCATCGCTAGCTCGATGAAGCTGCGTCGGTTGTGAAATCCTGCGAATTGGCGGAGGGCTGGCCACGACATTCTGC
GGCTCTTTCGTTTTTGAATTCACTATTGAGGAATTGCCGTCTTGAAGCTTTGGCTGCGAGTCCTTCCTGCTGTCTCTGCGTCCTGCGCTGGTTGGCGATG
CTGTAGTGGCGATGGCGGCTCGGAACTGCTCTCGAGGATCCTGCGGTGCTCGAGCAGTTCCGACCTCAGGTAGGAGTTTGTCACTTGTTGCTACCGAGTG
GTCCGTCCTCTTGGACGATGCCGCACGTGGATTCGAAGGGAATAGATCAGTCGGAGGTGCATTCCATCGCCGCTTGGCGACTGGGGCCAATCCACTTCTA
GGCCGGGCAGACAGCGGCTTGGAGGTCAGAGCAGCCGGAGGCTTGGCACTCGTCGCCAGCGACATCTCGCAATGGTGGAGACACAGGTGCAGCGTGAGAC
TCCGTCCGCCTATATTTACATGAGGCAAGAAGCTAAACATTGAACTAGTTACCTCCAGGCCACGGCGTGAACTTGGACGACAAACGGATCCCACTTTCAC
TGCTAGGCATTCTCGCGCACTTGGCATAGACGCACTTGGATGGCTTGGGGGCCGGTACAGCAGCAGTAGCCACCACAGTGCTCTCTCACTGGGAGTTAAT
CGATAGAATATCAACTACTTTGGGAGGAGGCTCCCGTACTCGGCGCCGACAAGACACCGCGTTGAAGTTGTCTCGGTGGTCGAAATTCTGAAACAAAGTC
TAAATTCTAAATCCTAACTGAAACGATGAATTTTGGCCAATCACCGGAAGTCACCCCAAAGGCGAAGTCAAGCCAAGACCAATTTGCTGCCGCCATGAAG
AAGAAAGTGGGTGTCGTCCTCCTTGCCCCTGCCTCTGCAGGGGCCATCTACTAACCCACGAGTGCGTCTACTGTATCGCGATGCGCGCAGGTTCTGCTGA
TGGGCAAGTCCGGCTCGGGCAAGACGTCCATGCGCTCTATCATCTTCGCCAACTACCTGGGTACGGAATTGCGTTCGGTGGCTGTGTTGGATCCCTCCCG
ACTAACTGAACGATGCGATTTATGTGCCAATTGACTAGCGCGCGACACCATGCGACTGGGACCCACGTGTAGGACGGAACTTTGACGATGCTTTAGCCCG
TCGAGATACATAGAGAATGACGTTTTCCTGCTTCTTGTAGTGGACGTGGAGCACTCGCACGTGCGATTCCTAGGCAACTTGGTGCTGAATCTCTGGGATT
GCGGCGGGTACAACGACAAGAACTGTTACTGCACTCGAGGCTGAAGCTTGTTCTAATGCTGCGTCGTGGTGTTTCTTGCAGCCAAGATGCATTCTACGAG
AACTACTTCGAGAGCCAGCGCGACCACATTTTCCGCAGCGTGGAGCTGTTGATCTACGTCTTCGACATTGAGAGTCGCGAATCGACGTACGTGGAGCTAT
CGAGGCTGTCTTAGTCTGGCTGCTGATGTTTTTTGTGTGCATTGCAGAAAGATATGGCGCACTTCGACGGCTGTCTTGAGGCTATCGACCAGAACTCAAG
CAACGCCAAGGTGTTCGTGCTCATCCACAAGATGGATCTTGTGCCGGAGGACCAGCGTGAGCGCGTACGTACGCATTGCCGAAGTTGGGGACAAAGCAAG
GTACGATGCTAACGATTTTTTTCGCGGTCATGTGCAGGTGTTCAACCAAAAGAAGGAAATGATTCTGGACCGCACGGGCCAATTGCCTACGGTGTGTTTC
GGCACGTCTATCTGGGATGAAACGCTGTACCGCGCGTGGTCATCCATTGTGTACTCGCTGATTCCGAACATGCAAGACCTGGAGAAGCACCTCAACAGCT
TCTGCTCCATTTGCAGCGCTGACGAGGTGGTGTTGTTTGAGCGTGCCACGTTCCTCGTGATCTCACACGCTACGCACACGAATCACCGCGACATTCATCG
CTTCGAGAAGATCAGCAACATTATCAAGCAGTTCAAGCTGAGCTGCAGTAAGACCCAGGCGCAGTTCCAGGGCATGGAGGTGCGTAACTCGAACTTCACG
GCTTACATTGACTTCTTCACTGCCAACACCTACATCATGGTCATCATGTCCGACGACTCGATCCGTAAGTTCCAGCATAACTGTGTTATTCTAGCGTTGA
AATGCATTTTCATACTAACAACTTGTTTGCCCTGGCGACATTTGATTTGAGTAGAGCCCGCGACGATTCACCTAAACATCAAGGCGGCTCGTCCTGTGTT
TGAAGAACATGTGCAGCAGACGAGCTAAGCTGCTATGATGGTCGATGTAATTGCCAAAGGATGCTTCTTGCAGTCTCCACCGATTCAGAGGCGCGCTCTT
CGGAGGACATAGTACCAACTGACTTGTATAGCTGGTGCTGAACCTAACTCTAATGCAGGAGCAGCTTTAACTTGACGATTTCCGAGCTTCTTTATTTCAT
ATACGCGCCAAGAGAGCTCCCAGGAACTCCACGCAGCGTTTGTTGGGAAATGCATTCCATGAAGTTTACTGAGGTGGCGGCGGCGGCGAACCTGACGAAT
TGGTTGCAGCAAGCATGTACCCTCTGCGTCTCAGCGCACGTAGAACCACGGGCGTGACGGCGAATGTAAGTGGCCACCGGACGGGGGCCAGCACCTTGTA
GATCGTGTAGGCGATGAGGAACGATCCGGCCGAGTTGGTTGTCGAGTCACTCACCGACGTGGACAAGCCCACTGCATCCAGAATGGACGTGATGTCCACG
CCGCTAGAGACACCCACGTAGATGACGGAGAACGACAGCAGCGACAGCACAATGTGCGTGCAGATCCCCACGCGGCCGTAGACGACAGCGAACGTCTGGG
CACGTTGACGCCACGACTGCGGCTGGAGCTGCTCGTCTCCAGGCTGCTCCAGCTCCTTCTCCGCGTCTTCTTCGCCCTGCACCAGCACAATAACACCATT
TACAGTGTCAAACCTGTTGCAGCAGCTTTTCAGATCCCCCAAAGGCAGCAAATCGCACCTTGACGGACGGCGACGATGTCGGTTCTCCACCAGTGAGCGG
CGCCGTCTCTTTCGGATCCTTGGACGTCCTGCCACTGGACCAGAGCCGCAGCATGCCACAGTTAGCACTGCGAGTCACAGGGAAGCCAAGCACATGGCGC
GACGCAGCGACGGCTGGAGGCCACGAGCAGGAAGGGGCGTGACCACTCTTGCCGCTGCTGGGGATGCTGGAGGACAGCGCTCGCGCCACGACAAGGCGCG
CCGCCCGCTGGAAGTCACATCACGCTGCGCCATGCCCCGATAAGCGCCCAAGTACCTCATTCCGCCGCGTAGCATCATCGAAAAGGACGCAGCGAGGCTT
GCAGCTTGATGACTTGGAATATCCACGATGTGGTGTACACCAAACACGACACTTTTCATCCTCCAACTGTCCCACACCGCGTCTTGGGCACTTGAAGCCA
TGTTTCGGGCTCCGACGCGCGGCTTCTGGGCGCTCCAGCGTCAATTGCGCGGCGTGTTGGCTGCCGATGCGTCCTCCCGAATGGGCGCCGGTCAGCGTGC
GCTACTCGCCACCACCAGCGAATCCAGAGACTCCGCGGAGTCGACCCACCAGCGACAGCAGTCGTCGTTCCTGCGCAGCGTCGACCTGAGTAGCCCCGCA
GCGCAGCGGAAGCTGTCCAAACTGATCCAGGAGGTGGTCAAAACCAAAGCCAATACCGGTGGTGCGTGCTGCAAAGCAGTTGCTAGAAGAGGATAGGAGC
TCACTTCTTGCTGCTACGGACAGATTTCGTGCCGCAAGTGATCGTCCAGAGCCTATGCACGACGTACCGAGGCATGAATATCGACGAGAAAAAGCAGTTT
CTGCTCATCTTGGCGCAGGACCTACACATTGACACGGCTCTGGTGCGATGGATGGATAGTAGGTAGTATTTCCACTTTGTGGGACTGACTGGGACTCTTT
TGTTTTGATTCTGTTGACGGTGAATAGGTTCTGCAAAGTGCTGCTCAGTTTGAGCAGAACTTGACTAATGTGCAAGACGCTCGCAGTGGTGTGGTGGACT
GGGAGCACGAGAACGTGGAGCGGTACTTGCGCACGTTTCGCAATCTTCGCAATGCTTTGTCACCACTGTATGAAGTAAGAGGCATTTACGGGGGCTGAAA
ACTGGATGGGATGCTTTCGAGGTTTTGTACTAACGGTAGCGACGCTTTCGACGGGGTAGACCTTCTTCCAGCAAATCTTGTCGCAACGCGAAAACGGAAT
GTTGTTCTTGGTACACATGCGAGCAGACCTGCTGCAGGTTTTGCGCAAAAACGCTAGCCATTCCGAAATCCCAGCTCTCCGTTCTTTAGATGCAGGCTTA
AAAGTAAGTCTTCATGTGTGTGTTATGTGTGTATTCATCTGGATTCAACCAATTACTCAGTATTCACGCGCCTTCTACACAGCAATTCCTAGCAGCGTGG
TTCAGCGTGGGGTTCCTGAAGCTGGAACGCGTGACGTACGAGCACTCCCCAGGCCAACTTCTGGAAAAGATCATTCGCTATGAAGCAGTGCACCCAGTTG
GTACAATCGCCGAGCTCAAGCGGCGCCTTGGTACGTCCGTGCAATCCAGAGCAATTGCACTTGAATTGAAATGTGACCCGTTTTCGGTTCTGCCTTTGTA
TTGTACTATGCTAGGCAATGGACGGCGCTGCTTCGCGTTTTTCCATCCGAGGTAAGATCTCGCATACCATCAATATTAATATTTAAGTCTGATCATGGAT
GTGCATGTGTTGTAGTATTCCGGATGAACCGCTCGTGTTTGTGCATGTAGCACTGATGCAAGAGATCGCCTCCAGCATGCAGTCAATTCGTGACCAAACC
GAGCAATTGGCAGAAGCCTCTCAAACGAAGGCTGCCATTTTTTACTCCATCTCCTCCACGCAAAAAGGACTTTCGGTAAGGGGTATCGCTTCTGGCATAC
ACATATCATTGAACTGATTTCGTTTATTCCAGGGTGTGGATTTAGGCAATTTTCTCATCAAAGAGGTTGCCAAAGCTCTCAAGGTGGAGTACCCGCTCCT
GAAAACGTTTGCGACGCTCAGCCCTTGCCGCAATTTATGCCATGGCTTGAAACCCAGCGATACAAGACTGATGAGTCGCTTGTTTCTCCTCTCGAGCTGG
ATGCCCTGATCGATGTCCTGGACGAGCGTGGCGTTACGATCAACCCGATTCGACCGCTGTGGCTATTGTCCTGGATGCACTCTCTATTGATGATTGGAGC
AAGGATGAAGATCTCGTTGCACCGTTGAAGCCTATGATGCTGAAGCTTGGCGCCCGCTATATCTACCACGAAAAGAAACGAGGTAAGGCACTGGACCCCG
TTACTAACTTCCACGTTCGGAATGGTGCCATTTTCGAGCGGATCAACTGGTTGGCTGATCTATCCAAGAAGGTGCGTGGCTCAGGCGGTTGATCGTTGAT
GTGCTCACAAAAAACCTACTTATCGATTTGCGATTTTTGTCCATGACTGCTTTATAGGGCCTCGCGCAAAGTGCTGGCATGATGATCAACTACAAGTATG
ATCTAGCACACGTGGAGGTGAACAATGAGAACTACTTGCTGCACAACATCATCCCCATTGGTCTCCAACCGCAGCAAGTTCTTGGAGCGCGTACGCTTTA
ATTGCGTCGCAGGAGAACTTTGTGTAGTACTTGCCAGTAGTAGAGCAGAAAGTTTGCTTGAATTCACAGTCTTGACACGTAAGGAACGTTTCTGTTTTTT
TGTTTTAAAGAAATCGACCAGAGCAGTCTTTTCTGGTATCCCTGTGAAGAGTCGTAGCGCAACGAAGCCGTGATGGTGTTGGCACAGGATGAGATCGATG
CTTGTCGGGAGGCATTCCTGGCTTTCGACAAGGATCGGTGAGGGCATTACAGATGGCCGTGCGATGATTGAACCTGACAGTGTGCTATTTTACGCTTGGC
AGGAGCGGAACAATCGATGTCTGGGAGCTGCGTCAAGTGCTAGAAGGTAAGTGCTGCGCCGGCTCTGGTTATTCAGGATTTGTTCCAACTAACGCGTCTT
GGATCAGCAATGGGGCAGCAGCCAACAGAGGAGGAACTATTCCAGATGATCAGTGAGGTTGATGAAGATATGAGCGGCGCAATAGGTAACCTTTTAGACG
CGACTGCAGCGGATATTGTACATTTAATCCTCATGCCACACCGGTACCAGACTTCGCTGAGTTTCTGCAGGTGATCGACAATCAAAAGGATCGCGCCGCT
ATGTTTGAGGATGACAGCGACATGAGTACGGGAATTTCGATTGAGGAGATTGCGGGAGGCGCTCTAAGTGTCATGTGTGCTTTCGTAGTTGATGCGTTTG
TTGCGTGCGGTGGCAAATCCGACAAAACGGGGTTTGTGCGCAAGGAGACGCTCGTGAAAATTATCAAGAGTGACTTTGGTCTCACTATCAACATTGAGGA
GATGATCAACAAGCTAGACGTGGATGGCAGTGGAGAGATCGAATTCGACGAGTTCAAAGCCATATTAACCTA