Description :
From Genome Similarity Track
Location :
contig_7:22007- 24818
Transcript NameFunction/comments
g2313.t1hypothetical protein

Sequence
2811 bases(100 bases per row)
ATGTATTCTTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGACTGTGTAGCCCCGCTACAACAACAAATTCACGGTTCCCGGTCTAAGAAAACCGAC
TACGACGGTAGGTTTAAAGACTGAATATATTTTATAGGTAAGCCAAGCTTGATCCTTACAAGCTCTAAGTCAACTATAGTAAAGCTAAACAAGTGCCTAA
TGGTTGGCTCACCGCCAACCGGTAGCACGTACCATGGGCACAAAAGAGAGAACATCCCGTCACTCTTTATGTAACATTGTAAAGTACGTGGAAAAAACAC
ATCAGGAAGGTGGCTTCTTGGAACTGGTGCGTATTCTGTAATGCATTGTACTGATCAACTTCAGCGTCGCCTGTAGGAACTGCTAGAACGATGTATGTAA
CTTGAACATTGTAGGCGTCTCCCGACCATTTCATGGTCCCCTGGGCAAATTTGACACAGTTGGGTGCGCTTGACGTACGCACCGGGACAGCACATATGAG
CTACCGTCTTACCCCGCACAAAGTGCCCAGGCGCAGTAATAAAATACTGCGCCCATTGAACACTGTATTCGTTTTGAGTGCCTAGGCATTGTACTACGAA
CAATACCTTCAACATAGAAGAACGGCAGCTCAGGTAGGTACCCTACAGCTAGAAATATGAGTCTGTTCCCTTTAACTTGTAATGTGCTAACGGCTCAACC
GGTTAGAGCATGGATTGTCGTACGACTAGTCCATGGTTCGATCCTGGGCGCGTCAATTGAGGGCCCAATATGGGAAGAGGGTTGTCGCGAGAAAAATCTC
GTTAATGCTCCGCACACAAAAGGTATGTCAAACTTGTCAAATTCAATTGGGAGAAATCAGAAACTAACATTGTTTTTGGTTTTTGTATCGGCCTTTATCC
TGCCTACACGAGGTATCCATCGACCTGAACAGCAAAATACCCGCCTCCTCGTACGAGGAACACGTCCTTCGTTGCATTTTCTGCTGTGTAAGTGAAGCTC
GTCGTGAGGCGAGACTGGTCATCGACTGTTTGGAGATTGATGTTCCATCCGTGCATCTTCGACGCGGCATAGATCTCGAGCTCAGCTGGATCTGTATTTC
CGTCTCTGATAGCCGCGAGTGTGGTGAAGTGGATGTTGGAAATTTCGTGATGGACCAACGATGGGCTAGGATCGGACGGGACCGGACGTACGATCGGAGG
TTGATGAAGGCAGACTTTGGAGGGATTAAATTGGACCTGAGGGGTAGGGGTATGGAGACCCAATGGGTACAGTGGCGCCATCAGTCATCGGTGTATACCG
GTATGCGGTATGGTGCGATCATTTCGATATGCGATCGTGGCCACCACTGCGATCGCGATCCTGATCGCAGATGGCGATCGTGACGTACCACTTTGGTGGT
ACGTCCGCAATCATTCCGGAGTAGAAGATCTGTGGAAGGTACCTCGGGAGATGGGTGAAAGAATCCAGTAAAGGGGGAGGTAGGAAGCTGAGGTCATTGT
TGCTTTTGCTTGTTTGTTTTACCTAATAAGAGAAGAAGAAGCTTTCCCTTGCAACACGAGTGGCGTTCGTTTATTCCAGGCTGGGAAGTATATTGGCCCT
CCTGACGACTTCGGACTCACCTCGTCGCGCAAGGTAATTACACGGGAGCCCCTGGATCGCTTGGCCAGGTGCGCAACCACTTAACCCCCCCCCCAGAAGA
CCCCGCCATAGGAGGCGGCAAGCACGTAAAGGAACACACCCAAGGACACCCCCCACGCCGATCAAGCCCCACCAGGCCCCGATCGGCAGACGACCGACGA
CCGCGTGAAGAATACCCGCGTGGCCGTCACCCCCAGTTCCCCGGAAGGAGCCGTCCAGCTCCCCACCCCATCCTGGTAACCACCGACGCCTTCAGTGAAC
ACCGGAAGAGCGTAACCCGCCCCGCCGTCGGGTACACAAGGTGAATACAAGGTTCCGATCGCGCCAGATCAACGGAGTACCCCCTCCGATAGTCGGCAGT
CCGGGCGTACCGCTGGTAAGCCGGAGATCACGACAGCAATTTTCGTGATCCCGCTTCGCCACAATGGTGCGCGTGCCCGGATCTTCTGGTGATTCACAGG
GATTTCACCGTGAGTCCACAGAAGAAGACGTCAAAATCAAGATGGAACCAGGGAACGAGTCGTCGACGGAAGAAGGATCGCCGCCGACGGCGCTGAAAGC
GCCAGGATCCACTGATCGTGAGAGTGCCGGGAGGAGCTCTGACGATGTGAAAGAGGAAGGTTCAGCGATGGACCTAGAAGAAAAGCCTCAAACCCCTCCC
CAGGTCCCCTCGGGGACCCCCGCGGATCGCGATGCGAATCGTGATCCGCCGGACGAAGGTCCGACGGTGAAAACCGAAGGACCTTCATCCAAAACCACTC
CTCCAGTTCCGCACGCAACCTCGAAGAAGAAGAAGTCGAAGCCCTCACGCAAGAAGCTGAAGGCACCGGAGTCTGAAGCCGAAGACCAGGAGGATTGCAA
CACGTGGACGGACGAGCAACTGGAGTCTGCCTTCTTCTACAAGGACCTTTACAAGTTCCTGCACGAAGACCCTGTAATGAAGATCGTGCGCCCGAAGCCA
ATTGGGGAACTGCAAGGTCCAGTGAAGGCACCGAAGGAAGTAACCAGCCAACTCGAGGCGGTGAAACTGCTGATGCGCATGCTGAAAGAAGCGGGAATCG
TGCTCGGCTCCTTCGACGCGAACGAGCTATTCGACTTGGAATTGCCAATCATCAGGGAATCAACGCTGAGCCTGTTCGCGAAGCTGACGCCCCTTGTCGG
TAGTGTCGTCC