Description :
From Genome Similarity Track
Location :
Scaffold_18:22007- 23271
Transcript NameFunction/comments
Albla_Nc14021930gagpol polyprotein putative

Sequence
1264 bases(100 bases per row)
AACACCGTCCAACTTACCAGCGCGAGCGACGCGGATTTTGCTGGTGACAAGATCAGCTACAAATCTGTGAGCGGGGCGATATTCCGTGTGGAGGGCATGA
TAGTAGGATGGATGTGCCGCAAACAACCGTCTTTGTCAATCTCAGCCATGGAAGCGGAGTTTACGTCAGTGTCGAACGACGGACAAGAGCTACTTGGACT
ACTCGAGGTACTCACTGAACTGAACTAAAATTCGAGGTGAAGCTGCCAATGACAATGGAGATGGATAACCAGTTGGCCATCCGACAGCTGAATAATGAGG
AGAGATCGTCTCGAGCAAAGATTATTGACATCAAGCTCAAGCTCGTTGAATATTGCGCGAGAAATGGCATCGTAAATCCAATCTTCGTGCCTATCGAAGA
GATGGCGGCTAATCTACTCAGAAAGCATTCAGCGCCGTTCGATTACAAAATTTGATGAGACTAAGCTTGCTAATTCGCACTACGACCAAACAACAGAGCA
AGGTACACGGTGAAAACACACAGCGCCGTAAGGAAGGAGTGTAGGAAGGTAATACTATTAGAATCTGTAAGTTTTAGTGGTGAGCTAATGACCAGATTTG
TTTGTCACAGGTCATGTGCGCATGCATGCTCTAGTAAGTTAACAAATAGAGATTAGCTTTTACTTTTACTTCTACCCACTTGTGCTCAAGCGCAGTGTAT
TTTAACAGGTTATGAGCCCAACGGATCGAATTGCTGATGCAGCCAAACCGGCTGCACCTGCTGATATGGTCGACAGTAGCGAAAGAGCCACTTACCACAT
CCATAAAGAAAAGTCGGAGGTGCCGGAGGCGGCACTGGTCATGGTACTCGCTATGCTCTGATACTTGTTTGAACAGATGTGCAGGATGGAATCCTCGCAA
TCCGGACACGCGAGTAAGCACCGAAAGGACTCCACGGAATCAAGCGATTTTGATTCGGTTTTGGGAGTTGGAGCAGCGATGAACCTCCAGGCTTTGGTGC
GTAACCCTTCTCCCAAAAGATCTCCAAATCTATCGTCAGCAACCTACGTTGGTGCTCGGCGTCCGGCTCAGGTTGCCGGCAACTATGATATGGGTCGGGC
ACCTGAACTAGATGTTCATGGGCAGCTTCTGCCGGTCTATCACTACCCATGTAGGGGTATACAAAATCCTGTCTTTGTACACCCCGGGCGTCAAATTAAA
GGAGTTCCAGATAGTCAACACAGAAGGTTGGCTCCGCAGCCATTTGATGGCAAAGATATTTATC