Description :
From Genome Similarity Track
Location :
Scaffold_1962:2200- 3396
Transcript NameFunction/comments
Phypl_g14461hypothetical protein

Sequence
1196 bases(100 bases per row)
TTCCTCCGAGTGGAGACGGAACAGCTctcgctgaagcagacgacACACCGAGCCAAGATTGCTGGACAGTTCGTCTTGGATCGCAGGGATGCGCTGTTCT
ACGTCAGTCGGAACACCCCCGAACGTCCCCGGAACGAAGCAGACCGGCTCAGATTGGTCGTGCCCCGGGATCTTCAGGTCGACGTCTTGCATCACTGTCA
TTCTGACATGCAAGGAGCCCACCAGGGGATCATCAGGCCATATGAGAGGTTGCGCCGGGAATTCTACTGGATAGGCATGTTCAGGTCCGCCGAACGATTT
GTCAAGGAATGCATGGATTGCGTGACCGCTAAAGGCCTGCCGCGGAACCCGGGAATCTCCCAGGGGAACATATTAGCGACCCGGCCCTTCCTCCATGGAT
TTCGTCATTCCTCTTCCCCGGACAGCCCGGGGTAACGAAGCCCTGCTCCTCTTTCAGTGCACTTTCTCAGGTTTCATCATGTGTAAATCCATGGAGCGCA
CGTCGACTCAAGATGTAGCCGAAGCCTACGAAGAGTGCGTGTTCCGGCGATTGGGTGCCAGTGAGATGATTCGTCACGACCGAGACCCCCGATTCATGGG
ACGCGTCTTCAAGCACTTTCGGGAGATGCACAGGAGTCGTCAACACGCGACCCTGGTATATCGACCCCAAGCCAACAGCCAACAAGAGAGGTCCGTGCAG
TCAGTCATCCGGTGTGTCCAAGCCTATGTACAAACCGTCGACCAAAGTGACTGGGACGAactcgccgagaagatcATGTGGGCACTGAACACGTCCAACG
ATGCTACCCGGCTCGAGACCCCTTTCTACCTGGTCCATAGCTGGGACGCCCAAGGAACGGTGGAAGCGATGATAGGCGAAGTTCCCCAggacgtccagct
ccgagatgCGTATGAGTGGCGCATCAAGTTACAGCGTCAAGCCGAGTACGCCAAGGCATCTCCAAGCCAATGCAAAGACCCGTCGAGCTCGGGAACACAA
CCAGCGATGGAAGCAACTCTCGAACCGCCTCAAGGAAGGATTCGAAGTGGGTGACTCCGTGTGGCTGTACCTGGCTCGGGTACGCCCGGGactgaccaag
aagctggcctACCTCTGGCATGGTCCTTTCAGGATTTTGGAGAAGGGTAGCGACTTCCGTTATcagctccaggtcgaagGGACTGACTACAGGTTC