Description :
From Genome Similarity Track
Location :
scaffold_783:22- 8988
Transcript NameFunction/comments
g10256.t1hypothetical protein
g10257.t1hypothetical protein
g10258.t1 hypothetical protein PHYSODRAFT_337674
g10259.t1hypothetical protein

Sequence
8966 bases(100 bases per row)
CCCTCGTACTTTCGTTTTGTATTAATTGGCCGGCCGTCGATAGCCTTTTGAAGAGTAGACCTCTCTCGCTCTTCCATGAGCATCTGAAGTGCGCTATCAT
TTTGCGCGGTAGGCGTGCTTCCTGCGGAATGAGGGACTGTGATTCATGGCGTGTCGTCGCTGAAGTGGCTGCAGCATAGTCGCGGATAGAGATGCCTGAC
TTCTTCTTCGCCATGGTGCTCTTCGCAAAATGACGTTTCGATACCAAAAATAAAGTATTGCATTTAGGTCACAATCGTGATAATGACTCGGGTCCGGACC
CATACAATCCAACAGATGATACTCATTAAGTAAATTGAATATTGTTTGGCAGCTTGACTTTTCAATTCGTAGCTCGTAAGAACTATCGATAGGGGCACTT
GTGTAGCAGTGAGAAGCACCGAGCTCACCGCGTCACGATTCTTCTCGTACTCGTCCTCAAAACCCTGAGTAATGAGAGTGTTAACACTCAGTTGTTTGTA
TGTGCATGCCGTACACATGATTATTGTATCCTCACCTTTTTCAGCTCTTCCAGCGGTTCAGGCGATTCCGCGTCGGTAAGATGTAATCGAACGAGGTTGT
ACTGCTTGTACTTGTGGTCTGAGATCCAGAGCAGTCTCAATCGGACTGTTACTTTCTCTTGTGAGCCGCTTGCCCGCGCCTTTGTGTACTCTTGAAGGTC
TACACAGGATTCCAAAGTGAGCACGTGAATACTAGCGAATGGCACACGACTTGCACCTTCCACACTGGTGATGACACGTTGATTCATCGTAGTGGTCGTA
GTTTGCGTCGAGAGAAGATATTTTGTGGTGTAGTAGTTCGCGAGGATTCTCGACGCGAGGGACACTCACACACTTGGCGTCCGGACTCCCGACTGACGGA
GGGGGTACTCCGCTTGCCGTCTGAAGATCTTCTCACCTTGTGTACCCGTCGGGTTGGACGATTACGCTCTTCTTGGGTGGCTCGTGGAAGACGCTGGGTT
TGATCTGGGTTGAGTATGTGTGGGCGGCACTTGGGTCTCGGCTTGACTGCTCGCGGTAACTCTTCACTCACAGTCGTTAGGGTGTAGATCTAGGCGTAGC
GAAGATCCACGGGTGTCCTAGGGTGAGGTTTACCAAAGGCCAATACAGTTCCAATATGTTGCTTGACCGCCTCCTTCTAGCGGTGGACTTGAGGGGGTGA
GTAGAGAGCGGGGCGACCTGGGCAAGCTATCTAGGCGTTCTTGCGCTTCTTCTTTGTAGACGGTGGCGATTCTGGGTCGTCAGAGGGGGCCAATATACTT
CCCAGCGCTGGAAATAGGTAGGACGCTTGTGTCTTGTAAAGAAGAACTCTCTCGCGGTGTTGAGTGTTTAAACTACTCTTCTGCACACTGAGGTAAATCT
AACACTGATTCCTACTCTTCCTATGCTCTCCTCCGCCCATCCCCTACGGTCCTTTAAGTCACCGACGGCTCCCAGCCTTACCTTTACGAACTGGCTCCAA
GATCGGACTTAGCACAAATTGTACCATCCTTCTGGAACACCTTGATCTTCCTGACATGTGTCGAAATGATTGCACCACGATCTTCCTGGCACCATGATCT
CCCCTGCAGTGTACCCGAAAAATGGTACTGTGATCTTCCCAGTAATGTACCAAGTGGGTGGTACCATTACCTCCGTATCACTGTACCAATCTGCTGGTAC
CTTCTCGGAAGAACTGGCTTTCCCACAAAACAAGATTCCCGCTTTACCACAGCCGCCCCCGCACTGAGGATAGGTCGTACAGCGATCGGGCCTCGTGCGT
CGTCTAACAGCATCCTGACGTGATCCCTGCGGTTCCTCATGGCTTCACCAAGTTCTCATAGCGGTTCTGGCTCATCGGGCAATCCTCCAGAGGTTCCTGC
CGCTGCTGATCCTACTACGGGTGAGTGTTCATGCTCCGTCCGACTTGAATTCGCTGTTCTCACCCCGCATCTGTCTTGTGTCAACGCCATACAGCCCATG
TTGAGTCCTCGGCCGTTCCTGACGCTCGTGTCACTGCTGGCGATCGTGATGGCAGTGATACCGACGTCGTGGAGATCGCGGCAACGTTGGTAGGCGGTCT
GCGGCAACTTGAAGCTTCTGTAGCCCCTACCGCGGCCCTGCCCCCCGTGGAAATTGACGAACACGGACTGCAGACATCCATTGTCGATCTCCAGAACATT
CTTGGTCAACTTGAGGCGTATCGCCTTCAGGCACAAGCATATTGTGATCTCCAGAAAGACCACGAAGGTCTTCAGCGTACACATGAGTTGTTGCGGCGGG
ATATCGCTGCTGTGCGGGCCGAATTGGTTCGAGTGGGGCAAATGGCTGCTCCGTTCGTGGCGTTCTGTTGGAGGAGATATGATCTCCTCCGCAACAGCCT
AGAAGACACCCAACTCCGCCTTGCTGAGACCGAGTCGGCTCTCGCTGATCGTCGTGATAATTCCCAGGAGATCGCGTGTCTTCAATATCGGCTGCAGGCA
CACCAGCGCTTACACGAAGATGTCGTAGCTGATTTCCAACGGCAAATGGACGATCTCGAAGCTCGTCTCGCGGTTTCTGGTCCTCCTGGCGGCTCGGCCT
AACTTGCGCAGTTGACCGCCGAACATGATGCTATCGTGATCGAGCGTGATACTCTCCGGGAAGAACGGGATGTCCTAACGGGCGAACTTCAGACAAGAAC
GACGTCTCTGCAGGACGCGGAGAACGCGGCGCGGCTCCTTCGTCAGCAGATTGCATCCTTGGGCGGCCAGATATCCGATCTACGCGTACAGATGGACAGG
GGACGTACTGGTTCTCGGCGTGTTCTAAATTGCAGTCTGGAAATGCGGGACGAGCTCCAGGCGAGACTTGAGCAGTCCACGGGCGGCCTCCAGACCAAGC
AGGCGTCATTGAGCAAAGTGTTGCAGTCTCAGTCGCGTGTTCAGCAGGATCTGGGCTCTAGTCTCGGCGTTGTTCTTCCTGGCGACCCGCTATCTTCCTG
GCTAAGCATGTTTATTGGGTCGTTTTGCTGTAGGGGATCAAGTCAATTCTCAACGCACTCGGATCGCGAATCTTGAACGTCAAATAGATGCATCACGGCA
GCATGAACTGGTTGCACAAAGGCTCAGCAGCGAGAAGATCGCGTTGGCGAAAACCCTCGAGTCGGAGCGTCAGGCTCGGATCGCAGCGGAGAACTCTAGC
GCTGTTGCAGTTCAAGGGCGTACGGCTGCAGAGGCCGACCAGGATCGTCTTCTAGTCCAGAGGCGCGCAGCGCAGGCTCAGCTAAACTCCCTAAGCTCGA
TCTTCGGCTCACAGGCATCGCCACAACCTCAGCGTCCTGCGACGGCACCTGATCCTCACCAGACTGCACCGGCCCAGCCAGATGCTTTGCAGCGGGGAAG
ATCTCTCTCACCAGGTCGTCGTCGTCCCTCTGCTCGAGGTCGTTCCCAGCGAGGGCGTTCAGTTCCCGCTGGGGCGAGCGTTCCTCCAGCCCAACGCAAG
AAACATGGTCAATCTACGGCGGGGTCTCTTGCCAAGCATTCCAAGAAACGTGGACGGTCTCCGACAGGGCTTCCTCCCAAGTCCAGGAAACGTGACCAGT
CTCCAACAGGGCTTCTTCTCAAGCGCCAGCGCGGACCACCGGCGGTTGGACCTGATGATGACGACGTGGACGACGCATTGCTCGCCGGGATGACAGCTTC
TCGGTCCACGGCACGTCGGAAACCTTCTACCGGCGGCACGCCCGCAGATCCCATTACTCTTGACGATGCCGAACCGGGCGCTGGAGACCAGAACCCTCCA
GGCCACGACGATGACCACGGCAGTTCCGGGGATCACGACGCTCTAAACCACGACAGTGACGACGCCGACGAGCATAATACTGGAGATTAACAGACCCAAC
AGCAAGATCGCGGTCGCGGAGGTCCCGGCCAAGTGGGTTTTAGCACGACAGCAGTGACAGTTCCAGCAGTGGAAACAGCGACGACGGCAATGGCTCGGGC
GGCGGTGGCAGCAGTGGATCTGCGGGCAGTAGTGGTAGTTCTAGCTTGATGTCGTCACATTCTTCGGACAACAGCCTTCTCTCGCGTCAAGAACACCGCG
ACCTGGCACCTACGGTGGTTCCCCGGGATCAATGGATCCCGGGTTATCGTAGCCCGGCCCAGTACGTGAGTGCAGCTGCCTGCGATCCCTGGCCTCTTCA
AGACGTTCGCCTCCTCAGCATACGTCGGCTACGTGCCAGCACTTTGTTCCAGCAGTGGACGCGTCCCAAATACTGGCTGTTCTCGCGGAGTACGCGGGCT
CCCAGCGCAGCCAATTGGTTCCCGGAGTTGATCACTGAGGCTAACGTCCGTGCACTGTACGCCGCTAGTCCTCCGCCCTGGAATGATCTGCGCACACTTG
TAGCGCCAAGATCTTTCGAATTAACGGGTTGGTTCGCCGACTTCGTCCGACTATACTCTGACTTCGAGGACGCACACCTCCAAGTGTTCTGGGAGACTAC
CCACAAGCTTCCAATCAGCGACGCCATGAAGTCGGCGACTCCGTTCTTGGCTCAGCACCAGGAAGACTGCCGCATTCGTAGTGTGAGAGCGGGGCCCCGG
TGGCGCACGTTGCTCAAGCACCTGATGACAGGCCTCAAGGACGGAGAGTGCGAGCTGGATCTCTTGCTATATCACCACTTCTTGCACTTCCCAGTGCGTG
GGGAGCAGGTCCAGTGGTATCCTGGCCTCGGTGAGCGACAGCGACCCGCTGACCTCCTAGCAGCTCTCCGGATCGTCGACACCGCTGACCCATGGCGTAA
CCAGCATCGCGCGAACATTGTGGATCACCCCAGATCTCGCCTCATGCGCCTCGACAGGAAGTTTTACGCCGCAGAATAGCGATTGAGCAGCTCGTTTTTA
ACATGTAGCTCCTCTCAGATAGCGTTGGAAGATTTCCTTCGATGTCTCCTCTTGTACTCACTTTAACCAATAACCCATCGAGCATTTGTGCGGCCACCCC
GCACAAATCTCTCCCCTTTCGCACCTACTGCGAAGGGTCTCCACCCACTTCTTCTTTGTGGGATTGCATAACGCCGAAGCTGTTGCGGCTGACCTAGCTT
CTTTCGAATTCGCGAAACGACGCCCCACAGTTCAAGTCAACCTCGTCCACCCACGTCGGATCATCATACCCCTTCCAGTGCACCAAGAACTCGCGGCAAT
TCCGTCCGTATCGCGTCTTCCGAGATGATCGTACGTCAGCAATTCGCTCCACTTAGTACTCATCCTCGTCTAACTCTCGTTCCCAGCTGTCCTCCGGCAA
GAAGGATTCATCGAAGTCCACGCGATCTTCATCGGGGGCGACGGTCTCCACCTTCGGGCGGTCAAGGAACTGCTTCACCAGCTTGAATTTCGACACGTGC
ACGATCGGGAAGATCCGGTATTCCGTCCCTGCGATCTCCAGCTTCGCAGCATGTTGATCGATCATCTCAGAAACACGGGATGGCCCATGCCAGAGGTGCG
CAAGCTTCCGGGCGTAGCCACCCTTGACGCGGTCCAGATACAGCCAGACCTGATCTCCGGCCTCAATGTGGTGTGGACGAAGATCTTTGTTGTGGTGATC
GGCGCGCTCGCGGATTGCTTCGCGCATTCGCTCGTTCACCTCCTCGCGGGCCCGCTGGTAGTGGCTCTGCATGTGGTTACGCCATCTCCGCGGATCGCGA
TCTCGGCGACGCGTGCTCCCCACAGGCAACGCTTCTTCCAGAGTGGATCTCGGATCCCAACCATGGACAAGGAAAAACGGCGTATCTCCCCGAACTCGAT
CTTGAGCCGTGTTCAGCGCGAACGTCAGCCGCTCGGCGTACTCGTCCCAGTCCTTCTGGTTTATGTCTGCGACATACATTTTGACTAATCGAGTCAGAGT
CTGGCTCTGCCGTCCCGTTGGCCTGAGGCCGGTAAGCCATCGTCGGGCTTTGTTGTTGACCCACAATACGATTGAACGCACGGAAGACGTCTGCCATGAA
CCCAGGCTCGCGATCGTGCCGGATGACTTCGCTCGCCCCAAAGCAACGGAAGACTCTCTCCTCATAGATCTGGGCAATCTGTTGCGCGGTCCGGGCGCTG
CTTGGTTTCGCCAGCACGTACCCGGTGAACAGGTCTACCTAGATCAAGAGCTCCGTGTTCCCTTTGTACGACTTCGGGAGCGAGGGGATGTGATCCATAG
CGATGATCTGGAACGGGTAAGTGGCCTGCAGGTTCCCGGGCGATCTTCCCTGAATGATAGGTCTTCCTTTTCCAGTCTCGCAGCCAACACATTCATCAAC
GTATCTCTGAACATCTCGGAACAGGCCGCTCCAGTGGAAGTGCTGCTTGATCCGCGCGTACGTTCTTCCGATCCCCTGATGCCCGCCTTCAAGGCTCGCA
TGGTAGTGATGCAGGAAGTCTTGGCGCAGCAATTCCGGGACCACCTACGTGGCGACAGCGTCGCGATCTTTATCAGATCTAGACGTGGAGATCGGGCAAC
ACAGCAGGAGTCTATCGTCATCTACCTCATACGAGTCAGCGATCTTCGCACAAGTCCGGGCGTCCTTCGCCGCCAGATCCGCCACGTCCCCTGTCAGGTA
CGTCTTCAGATCGGCGATCCACGCCTCTCCCCCTTGTGCTTTGACGATGCGTTTTAACCTCATGCTTTGAACCACTGATTCCTGCAGGCATTCCGGTGGA
GCACGCCTTCGTGTGGACGATCGGGTCACGGCGGAGACACGGACGACGTTCTCCTCGTTCTTCGGCTTCAAGATCTCTCCAAGCCGATTGAGTGTGACCA
AGTCTTCGCCTGCAGAGCTTCGCTGGCGAGACGATCGGCGCTCTGGTTGCATTCCCGCTTCACGTGCACGAACTCGTGCTGAGGCCACGACAAGAGTTTG
CTCGTCGCTTTCTCGCGCAGGAGCTGCAACGCTGGCGCCTTACATGCGATCTCGCCACGCATCTGCCGGATCACCAAGTTGGAATCTCCGCAGATCACCA
GGCGTCCCCTGTCAAGAGGTGACAGGAGATCCAGGCACAGAAGCAGTCCATGGTACTCAGCTTCGTTGACGGTCATCTCGGTCGCGTACTGAGACGCCGC
CGTGAGGATCGTCGACTCTAGCAGCTTCCAGACGGCAGCGCTGTATGCTCCGCCGCCACGTTTCACACGAGCAGACCCGTCAAAGCTCACGACGATCAGC
TCTTCATCCAGTTCGACCGTTGGCGTGGGCGCGACGATCACTTGCCGGGGATACTTCCTGGGGGCGACTGCAACCAGGGCTTCATCTACCTCTTCCCGAG
GGGTGATGCTCGCAGCCAGCGTTCCCAAGCCTTCGTCTTCGCCCTTCGTACATCGCACGATCTCCAGCGCCCATTGAGACAGGAGTGCAGCCCATGAACC
GAGACGACCTTGAAGACCTGAGGGTTGAAGCAGCCAAGCGAGCGTCGAGTATCGCGACAGCACCTTGATCGACTTGGCGACCAGCATGGTGTGGCAGACG
TCGAGGATCCGCAGCAAGGCCAAGACCTCCTTCTCGACGATCCCGTAGTTGAGTTCGTTCAACTTCAGGATGCGACTGGTGAAGGTCACTGACCAGAACA
CGGCATCAGGTTCTTGCATGAGAGCCGCGGAGATCGCCCACTTGTTCGCGTAGACCACGATGACTGGGGGGCGATCGGGATCGAAGTGCTTCAAGGTCGG
GGTTGACACGATCATCGCCTTCAGCATGGTGAACGCGACGGTGGCTCTCGTCCAGCGGTCCTCCTCATCCTCTACTTGGTCAACGCCCCCTGTCTGCAAT
GGACGGTCCGTGATCTTGCTTCGGCGGCGAAGCTCGAAGAAGTCCGACTCACGCAGCACGTACAGGATCGCGGCGTACACTGCGAAGTCCTCGATGAAGC
GGCTGTAGTAATTTAAGCTGCCGAGGAACGACTGCATCACGCGCAGTGTCTGCGGGAACGGCAAGTTGCACAGCGCCTTCACGTCCTTGGGCCGCGCTTC
AAGTCCTTCGATCGAGGCTCGATGACCAAGATAGTCCACCTTGCGCATGCCCCAAGAACTCTTGACCATGCTGATGGACAAATTCCAACGATCGCAGGCG
TCGAGCAGCTTCTCGACCTTCCCGCAGAGATTGTCCCACGAATCTGCAGTGACCAAGATGTCGTCAATGTACGACTGCCGCCCTAGTACCGAAGGTTTGT
GGTCCGTCTCCGGCTCGCCTGCGTCGAACACGTCAGCACGATCTTCGGAGTCTTCGCCATTGCCGATCCGGAGGAATCCATACATGACATTGTCCAATAA
CCGCTGGTAGATCTGCGGTTCTTCAAGCCGAACGGCATGCGGGTCCATTCGAACAATCCGAAGGGCGTAATGAACGCCAAGATCTTCTGAGCGCGCTCTG
TCATCTGAACTACCCAGAATCCGCTTGTCATGTCCAAGAAACAGTACCAGAGGACCTTGTCAAGATCTTCAAGGAGATCGTTGATCAAGAGCATGGGATA
CACCATCGGTCTGGTGAGGGAGTTCACCAAGCGGTAGTCGATGCAGAGCCGAATGTCCACCCCGTTCTTCTTGATGATGGTCACGATTGTAGACGCCCAT
GAGGAGGTGGAAGGAACGATGATCTTCGCCGCCAACAGTCCCTTAATAAGTCGGAGAGTTTCTCGCGAAACTGTGGGGCTACCCGACGAACGCGTTGCGC
GATCGGGGCCACACCTCCCACGTCGATGTCGCATACCACCCCTACTGCTGCTGGCGGCAAGGCGTTCCCCTTCCCGAGCAGAAGATGGTTCCTCCTCCAG
ATGATACGCCTCAAGCGGTTGATCTCCTCCCGCGTATTCCACTCGGGATCTCCAGCCTGGATGTCTTCCATCTTGACTTTCTCTGTCGTGCTCACGATCT
CGGGCAGGACAGCCATCTGTCCCTCATGATCTTCCGCAACGAGACTTCCGCCATGGTGATAATACC